FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637030_at:

>probe:Drosophila_2:1637030_at:437:629; Interrogation_Position=243; Antisense; TCCTCAGCCGTCGTATTTGGGATAC
>probe:Drosophila_2:1637030_at:174:131; Interrogation_Position=268; Antisense; ACCTATCAGTTGGTGCCTCAATGGC
>probe:Drosophila_2:1637030_at:496:369; Interrogation_Position=341; Antisense; GAATGATATCCTTTGTGCAGCTGCC
>probe:Drosophila_2:1637030_at:172:231; Interrogation_Position=394; Antisense; AATGTGACTGGATTGCCACCCGGTA
>probe:Drosophila_2:1637030_at:536:617; Interrogation_Position=428; Antisense; TGCATATTCACACCTTTGGCGATCT
>probe:Drosophila_2:1637030_at:518:727; Interrogation_Position=443; Antisense; TTGGCGATCTCAGCGATGGTTGCAA
>probe:Drosophila_2:1637030_at:586:29; Interrogation_Position=491; Antisense; ATAACTTTCTCGGTAATGTGGACAC
>probe:Drosophila_2:1637030_at:586:607; Interrogation_Position=522; Antisense; TGATGGCAGCATCTCGGCGGTCTTT
>probe:Drosophila_2:1637030_at:69:419; Interrogation_Position=549; Antisense; GAGCATTTACCTGCAATTGTTTGGC
>probe:Drosophila_2:1637030_at:27:725; Interrogation_Position=587; Antisense; TTGGGCGTTCCATAGTGATACACAG
>probe:Drosophila_2:1637030_at:245:237; Interrogation_Position=618; Antisense; AATCGATCTGAATACTGCCCTAAAT
>probe:Drosophila_2:1637030_at:63:165; Interrogation_Position=678; Antisense; AAATCCCCTGGCCTATCAGAACGAG
>probe:Drosophila_2:1637030_at:372:75; Interrogation_Position=701; Antisense; AGGAGAATTCACTGGGTCCTGCCAT
>probe:Drosophila_2:1637030_at:682:91; Interrogation_Position=742; Antisense; AGTATTATGAGCACAGCCGCCAGTT

Paste this into a BLAST search page for me
TCCTCAGCCGTCGTATTTGGGATACACCTATCAGTTGGTGCCTCAATGGCGAATGATATCCTTTGTGCAGCTGCCAATGTGACTGGATTGCCACCCGGTATGCATATTCACACCTTTGGCGATCTTTGGCGATCTCAGCGATGGTTGCAAATAACTTTCTCGGTAATGTGGACACTGATGGCAGCATCTCGGCGGTCTTTGAGCATTTACCTGCAATTGTTTGGCTTGGGCGTTCCATAGTGATACACAGAATCGATCTGAATACTGCCCTAAATAAATCCCCTGGCCTATCAGAACGAGAGGAGAATTCACTGGGTCCTGCCATAGTATTATGAGCACAGCCGCCAGTT

Full Affymetrix probeset data:

Annotations for 1637030_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720