Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637031_at:

>probe:Drosophila_2:1637031_at:191:627; Interrogation_Position=1647; Antisense; TGCCGACGCAGGGTCAGGCCAAGTA
>probe:Drosophila_2:1637031_at:656:495; Interrogation_Position=1659; Antisense; GTCAGGCCAAGTACTGGTCATGATT
>probe:Drosophila_2:1637031_at:671:655; Interrogation_Position=1684; Antisense; TAATGAATCGCCGACGTCGCTGTAC
>probe:Drosophila_2:1637031_at:102:503; Interrogation_Position=1699; Antisense; GTCGCTGTACGACCGAGAATCATTA
>probe:Drosophila_2:1637031_at:714:421; Interrogation_Position=1713; Antisense; GAGAATCATTACATTTTCGCGTTAG
>probe:Drosophila_2:1637031_at:684:715; Interrogation_Position=1728; Antisense; TTCGCGTTAGTTTTATGCATTTCAA
>probe:Drosophila_2:1637031_at:292:345; Interrogation_Position=1744; Antisense; GCATTTCAATTATCAGCAGAGGCAC
>probe:Drosophila_2:1637031_at:267:437; Interrogation_Position=1762; Antisense; GAGGCACATGTAAATCTTAGGCAAC
>probe:Drosophila_2:1637031_at:509:517; Interrogation_Position=1808; Antisense; GTGTGGTAAACATCGGCTTGGCTAT
>probe:Drosophila_2:1637031_at:35:463; Interrogation_Position=1840; Antisense; GATTACTTTGCTTGCTGCATGTGCA
>probe:Drosophila_2:1637031_at:221:333; Interrogation_Position=1892; Antisense; GCTGGCAACGTTTCCATACATGCAT
>probe:Drosophila_2:1637031_at:110:57; Interrogation_Position=1969; Antisense; ATGTTGTTCAGCCTAGTACATCGGG
>probe:Drosophila_2:1637031_at:290:381; Interrogation_Position=2158; Antisense; GAACGGAAGGATCTTGCTGCAATTT
>probe:Drosophila_2:1637031_at:197:529; Interrogation_Position=2194; Antisense; GGGTAACACGCTGCCTGTTAAGGAT

Paste this into a BLAST search page for me
TGCCGACGCAGGGTCAGGCCAAGTAGTCAGGCCAAGTACTGGTCATGATTTAATGAATCGCCGACGTCGCTGTACGTCGCTGTACGACCGAGAATCATTAGAGAATCATTACATTTTCGCGTTAGTTCGCGTTAGTTTTATGCATTTCAAGCATTTCAATTATCAGCAGAGGCACGAGGCACATGTAAATCTTAGGCAACGTGTGGTAAACATCGGCTTGGCTATGATTACTTTGCTTGCTGCATGTGCAGCTGGCAACGTTTCCATACATGCATATGTTGTTCAGCCTAGTACATCGGGGAACGGAAGGATCTTGCTGCAATTTGGGTAACACGCTGCCTGTTAAGGAT

Full Affymetrix probeset data:

Annotations for 1637031_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime