FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637032_at:

>probe:Drosophila_2:1637032_at:419:119; Interrogation_Position=1027; Antisense; AGCGGCGAATGCACAGTTTGTTCAC
>probe:Drosophila_2:1637032_at:275:727; Interrogation_Position=1044; Antisense; TTGTTCACGCACATCCTGGTTGATA
>probe:Drosophila_2:1637032_at:235:491; Interrogation_Position=488; Antisense; GTACATGCACAATTACCTGCCGCAG
>probe:Drosophila_2:1637032_at:163:353; Interrogation_Position=509; Antisense; GCAGCAGCTGATCCACTATCGGATT
>probe:Drosophila_2:1637032_at:642:541; Interrogation_Position=529; Antisense; GGATTTTCCTGGTCGAACAGTTCGA
>probe:Drosophila_2:1637032_at:682:661; Interrogation_Position=566; Antisense; TAACAGGGCGATGCTCTTCAACATT
>probe:Drosophila_2:1637032_at:225:621; Interrogation_Position=605; Antisense; TGCGGAGTATGGATTTCCCTGCCTC
>probe:Drosophila_2:1637032_at:416:631; Interrogation_Position=649; Antisense; TCCTGCCACTGAATTCGGGTCAAAT
>probe:Drosophila_2:1637032_at:391:383; Interrogation_Position=687; Antisense; GAACGTCCACGGCACATGAGCTCTG
>probe:Drosophila_2:1637032_at:243:569; Interrogation_Position=801; Antisense; GGCATGTCCAATCTGTATTACGGCT
>probe:Drosophila_2:1637032_at:580:617; Interrogation_Position=859; Antisense; TGCAGGCCCTGAATATCGACATTTG
>probe:Drosophila_2:1637032_at:54:619; Interrogation_Position=882; Antisense; TGCCGATTCGCAATGGAGTTCAGTA
>probe:Drosophila_2:1637032_at:242:521; Interrogation_Position=954; Antisense; GTGGCACTGCTGAGATCGGCGACTC
>probe:Drosophila_2:1637032_at:40:441; Interrogation_Position=993; Antisense; GATGGACTCAACTCACTGGTGTACA

Paste this into a BLAST search page for me
AGCGGCGAATGCACAGTTTGTTCACTTGTTCACGCACATCCTGGTTGATAGTACATGCACAATTACCTGCCGCAGGCAGCAGCTGATCCACTATCGGATTGGATTTTCCTGGTCGAACAGTTCGATAACAGGGCGATGCTCTTCAACATTTGCGGAGTATGGATTTCCCTGCCTCTCCTGCCACTGAATTCGGGTCAAATGAACGTCCACGGCACATGAGCTCTGGGCATGTCCAATCTGTATTACGGCTTGCAGGCCCTGAATATCGACATTTGTGCCGATTCGCAATGGAGTTCAGTAGTGGCACTGCTGAGATCGGCGACTCGATGGACTCAACTCACTGGTGTACA

Full Affymetrix probeset data:

Annotations for 1637032_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720