FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637033_at:

>probe:Drosophila_2:1637033_at:317:593; Interrogation_Position=2061; Antisense; TGGGAGTGGCACGAGCTCATCGATC
>probe:Drosophila_2:1637033_at:445:489; Interrogation_Position=2090; Antisense; GTACATGGCCCAACTACTGGACAGA
>probe:Drosophila_2:1637033_at:126:221; Interrogation_Position=2137; Antisense; AAGTGCTCGTCGTCTGGCTGAATCA
>probe:Drosophila_2:1637033_at:222:551; Interrogation_Position=2177; Antisense; GGAGATCTCGCGATGGTACACCGGC
>probe:Drosophila_2:1637033_at:39:325; Interrogation_Position=2233; Antisense; GCGAGCCCAGCGTTAAAGAGCATCT
>probe:Drosophila_2:1637033_at:670:345; Interrogation_Position=2252; Antisense; GCATCTGCGGCGAGCACTGGAAATT
>probe:Drosophila_2:1637033_at:38:15; Interrogation_Position=2274; Antisense; ATTATGCACAGAGCCAGCGATACCC
>probe:Drosophila_2:1637033_at:584:231; Interrogation_Position=2357; Antisense; AATGATGGACCTGATTCATCCGCCC
>probe:Drosophila_2:1637033_at:103:233; Interrogation_Position=2416; Antisense; AATGCGCCGACTTGGGAATCATCTT
>probe:Drosophila_2:1637033_at:162:121; Interrogation_Position=2494; Antisense; AGCTGTTTTGCTACATCGATCGTCA
>probe:Drosophila_2:1637033_at:120:637; Interrogation_Position=2509; Antisense; TCGATCGTCACGTCTGCATGGTCAG
>probe:Drosophila_2:1637033_at:663:65; Interrogation_Position=2526; Antisense; ATGGTCAGCGATGGCAGCTTCAGCA
>probe:Drosophila_2:1637033_at:119:319; Interrogation_Position=2558; Antisense; GCCGGTGTCGCTAAATCATCTGCTA
>probe:Drosophila_2:1637033_at:113:379; Interrogation_Position=2583; Antisense; GAACGCTCTCAAACGGGAATTCTTT

Paste this into a BLAST search page for me
TGGGAGTGGCACGAGCTCATCGATCGTACATGGCCCAACTACTGGACAGAAAGTGCTCGTCGTCTGGCTGAATCAGGAGATCTCGCGATGGTACACCGGCGCGAGCCCAGCGTTAAAGAGCATCTGCATCTGCGGCGAGCACTGGAAATTATTATGCACAGAGCCAGCGATACCCAATGATGGACCTGATTCATCCGCCCAATGCGCCGACTTGGGAATCATCTTAGCTGTTTTGCTACATCGATCGTCATCGATCGTCACGTCTGCATGGTCAGATGGTCAGCGATGGCAGCTTCAGCAGCCGGTGTCGCTAAATCATCTGCTAGAACGCTCTCAAACGGGAATTCTTT

Full Affymetrix probeset data:

Annotations for 1637033_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720