FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637034_at:

>probe:Drosophila_2:1637034_at:226:335; Interrogation_Position=527; Antisense; GCTCGCCTCCCATGGAAGCCAAGTT
>probe:Drosophila_2:1637034_at:236:379; Interrogation_Position=541; Antisense; GAAGCCAAGTTACGCAAATCAGTGA
>probe:Drosophila_2:1637034_at:330:511; Interrogation_Position=562; Antisense; GTGAATAAGTCAAATCCCCAAACTA
>probe:Drosophila_2:1637034_at:221:663; Interrogation_Position=585; Antisense; TAAACCCACCGAAGAATCCTCTGCT
>probe:Drosophila_2:1637034_at:604:367; Interrogation_Position=598; Antisense; GAATCCTCTGCTCAAACAGATAGGG
>probe:Drosophila_2:1637034_at:537:25; Interrogation_Position=668; Antisense; ATAAAACCATCGAAGAAGCCTCTGC
>probe:Drosophila_2:1637034_at:488:379; Interrogation_Position=682; Antisense; GAAGCCTCTGCTCAAACAGATTTGG
>probe:Drosophila_2:1637034_at:371:237; Interrogation_Position=724; Antisense; AATCAAGTGCATGAATCCCAAACTA
>probe:Drosophila_2:1637034_at:139:389; Interrogation_Position=757; Antisense; GAAAAAGCCTCTGCTCAAACAGAAA
>probe:Drosophila_2:1637034_at:338:95; Interrogation_Position=792; Antisense; AGAGCCGGATAGTGAAGGTTCCATT
>probe:Drosophila_2:1637034_at:229:269; Interrogation_Position=859; Antisense; CAGGAGAGGAACTTTTACTTATCAA
>probe:Drosophila_2:1637034_at:176:707; Interrogation_Position=873; Antisense; TTACTTATCAAAACTCCGAGCTATT
>probe:Drosophila_2:1637034_at:644:419; Interrogation_Position=890; Antisense; GAGCTATTGATCATATTTGCCAGAA
>probe:Drosophila_2:1637034_at:511:249; Interrogation_Position=996; Antisense; CAAATAAACTGCATTCAAATCGGCT

Paste this into a BLAST search page for me
GCTCGCCTCCCATGGAAGCCAAGTTGAAGCCAAGTTACGCAAATCAGTGAGTGAATAAGTCAAATCCCCAAACTATAAACCCACCGAAGAATCCTCTGCTGAATCCTCTGCTCAAACAGATAGGGATAAAACCATCGAAGAAGCCTCTGCGAAGCCTCTGCTCAAACAGATTTGGAATCAAGTGCATGAATCCCAAACTAGAAAAAGCCTCTGCTCAAACAGAAAAGAGCCGGATAGTGAAGGTTCCATTCAGGAGAGGAACTTTTACTTATCAATTACTTATCAAAACTCCGAGCTATTGAGCTATTGATCATATTTGCCAGAACAAATAAACTGCATTCAAATCGGCT

Full Affymetrix probeset data:

Annotations for 1637034_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720