FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637035_at:

>probe:Drosophila_2:1637035_at:31:201; Interrogation_Position=3652; Antisense; AACCCACTTCTGGATAGCAGCAGCA
>probe:Drosophila_2:1637035_at:255:265; Interrogation_Position=3714; Antisense; CAGATCGCCCAGTACAAAGTTCCAG
>probe:Drosophila_2:1637035_at:529:171; Interrogation_Position=3729; Antisense; AAAGTTCCAGCAATCCATGGCCAGG
>probe:Drosophila_2:1637035_at:658:53; Interrogation_Position=3754; Antisense; ATGCAGATGCTCTTTGGCGGCGCAG
>probe:Drosophila_2:1637035_at:174:577; Interrogation_Position=3772; Antisense; GGCGCAGAGGCCGTAAAACCTACAA
>probe:Drosophila_2:1637035_at:473:73; Interrogation_Position=3810; Antisense; AGGAAGACCTGTGAGTGCACCCACC
>probe:Drosophila_2:1637035_at:247:517; Interrogation_Position=3855; Antisense; GTGTGCACATTTGGTGCTCCCGAAA
>probe:Drosophila_2:1637035_at:669:379; Interrogation_Position=3922; Antisense; GAACCAGCTGTTCATCATTTGGATG
>probe:Drosophila_2:1637035_at:365:37; Interrogation_Position=3935; Antisense; ATCATTTGGATGTCTCCACTTCCAG
>probe:Drosophila_2:1637035_at:538:149; Interrogation_Position=3952; Antisense; ACTTCCAGTTCTTCGCAAAGCACTT
>probe:Drosophila_2:1637035_at:247:43; Interrogation_Position=3987; Antisense; ATCGTCGGGCGAAGCTTTCGAGGAT
>probe:Drosophila_2:1637035_at:709:635; Interrogation_Position=4004; Antisense; TCGAGGATTTGGTCATGAGCGCCGT
>probe:Drosophila_2:1637035_at:698:51; Interrogation_Position=4052; Antisense; ATGCGGAATCTAGCACGGAGGTTTC
>probe:Drosophila_2:1637035_at:237:427; Interrogation_Position=4069; Antisense; GAGGTTTCGTACAGCCAGGCGTTCT

Paste this into a BLAST search page for me
AACCCACTTCTGGATAGCAGCAGCACAGATCGCCCAGTACAAAGTTCCAGAAAGTTCCAGCAATCCATGGCCAGGATGCAGATGCTCTTTGGCGGCGCAGGGCGCAGAGGCCGTAAAACCTACAAAGGAAGACCTGTGAGTGCACCCACCGTGTGCACATTTGGTGCTCCCGAAAGAACCAGCTGTTCATCATTTGGATGATCATTTGGATGTCTCCACTTCCAGACTTCCAGTTCTTCGCAAAGCACTTATCGTCGGGCGAAGCTTTCGAGGATTCGAGGATTTGGTCATGAGCGCCGTATGCGGAATCTAGCACGGAGGTTTCGAGGTTTCGTACAGCCAGGCGTTCT

Full Affymetrix probeset data:

Annotations for 1637035_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720