Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637036_s_at:

>probe:Drosophila_2:1637036_s_at:160:221; Interrogation_Position=511; Antisense; AAGTGCAACAATTTCCACGGCCACG
>probe:Drosophila_2:1637036_s_at:393:141; Interrogation_Position=527; Antisense; ACGGCCACGGACACAACTATACAGT
>probe:Drosophila_2:1637036_s_at:139:723; Interrogation_Position=551; Antisense; TTGAGATAACCGTCCGTGGTCCCAT
>probe:Drosophila_2:1637036_s_at:470:143; Interrogation_Position=631; Antisense; ACTGTGATTATGAAGCGCCTGGACC
>probe:Drosophila_2:1637036_s_at:68:301; Interrogation_Position=646; Antisense; CGCCTGGACCACAAGAATCTCGATA
>probe:Drosophila_2:1637036_s_at:363:189; Interrogation_Position=712; Antisense; AACTTGGCCGTTTACATCTGGGACA
>probe:Drosophila_2:1637036_s_at:377:159; Interrogation_Position=734; Antisense; ACAACATCCGTCTGCAGCTGAAGAA
>probe:Drosophila_2:1637036_s_at:51:509; Interrogation_Position=778; Antisense; GTGAAGATCCATGAGACCCCAAAGA
>probe:Drosophila_2:1637036_s_at:571:211; Interrogation_Position=799; Antisense; AAGAACATTATCAGCTACCGCGGCC
>probe:Drosophila_2:1637036_s_at:687:483; Interrogation_Position=825; Antisense; GTATCCGCTCAATGGCATCTACAAC
>probe:Drosophila_2:1637036_s_at:76:129; Interrogation_Position=883; Antisense; ACCAACATCTCGTCGGATTCGGATT
>probe:Drosophila_2:1637036_s_at:316:375; Interrogation_Position=916; Antisense; GAAGATTGTGACATCGCCTAACGAA
>probe:Drosophila_2:1637036_s_at:260:605; Interrogation_Position=958; Antisense; TGATCAGCGAAGACTCAGCCAACCT
>probe:Drosophila_2:1637036_s_at:628:253; Interrogation_Position=977; Antisense; CAACCTCTTAAGCACGCGCGTAGAA

Paste this into a BLAST search page for me
AAGTGCAACAATTTCCACGGCCACGACGGCCACGGACACAACTATACAGTTTGAGATAACCGTCCGTGGTCCCATACTGTGATTATGAAGCGCCTGGACCCGCCTGGACCACAAGAATCTCGATAAACTTGGCCGTTTACATCTGGGACAACAACATCCGTCTGCAGCTGAAGAAGTGAAGATCCATGAGACCCCAAAGAAAGAACATTATCAGCTACCGCGGCCGTATCCGCTCAATGGCATCTACAACACCAACATCTCGTCGGATTCGGATTGAAGATTGTGACATCGCCTAACGAATGATCAGCGAAGACTCAGCCAACCTCAACCTCTTAAGCACGCGCGTAGAA

Full Affymetrix probeset data:

Annotations for 1637036_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime