Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637037_at:

>probe:Drosophila_2:1637037_at:708:225; Interrogation_Position=3938; Antisense; AAGGCGGCTCGTGTGGATTTGATCT
>probe:Drosophila_2:1637037_at:452:713; Interrogation_Position=3974; Antisense; TTCATGCGTGTCCTGAGTGCTCCAT
>probe:Drosophila_2:1637037_at:265:621; Interrogation_Position=3991; Antisense; TGCTCCATTCGTTCGAGAGTGGCGT
>probe:Drosophila_2:1637037_at:486:329; Interrogation_Position=4012; Antisense; GCGTGGACGGCTCGTCAATATCCAT
>probe:Drosophila_2:1637037_at:618:217; Interrogation_Position=4052; Antisense; AAGTATCCTGGTCTGCATGTCCAGA
>probe:Drosophila_2:1637037_at:686:169; Interrogation_Position=4099; Antisense; AAAGGAGTCCGGCTGCACGGTTCAC
>probe:Drosophila_2:1637037_at:338:123; Interrogation_Position=4150; Antisense; AGCGATCATTGTTCAGGCTGCTGTT
>probe:Drosophila_2:1637037_at:340:603; Interrogation_Position=4171; Antisense; TGTTCCCATTTTGCCCGATGACGAC
>probe:Drosophila_2:1637037_at:507:611; Interrogation_Position=4189; Antisense; TGACGACGAGGATTCGCTGACCCAA
>probe:Drosophila_2:1637037_at:518:197; Interrogation_Position=4212; Antisense; AACGCATCCACAAGGCTGAGCACTG
>probe:Drosophila_2:1637037_at:106:609; Interrogation_Position=4228; Antisense; TGAGCACTGGGCTTTTCCAAGGGCA
>probe:Drosophila_2:1637037_at:416:561; Interrogation_Position=4271; Antisense; GGAACAGCTCTCATTTCTCCGGAAG
>probe:Drosophila_2:1637037_at:392:695; Interrogation_Position=4284; Antisense; TTTCTCCGGAAGTCAGCAGTCAGTA
>probe:Drosophila_2:1637037_at:5:479; Interrogation_Position=4459; Antisense; GTTTAGGCTGCGTTTCTTTTTATAT

Paste this into a BLAST search page for me
AAGGCGGCTCGTGTGGATTTGATCTTTCATGCGTGTCCTGAGTGCTCCATTGCTCCATTCGTTCGAGAGTGGCGTGCGTGGACGGCTCGTCAATATCCATAAGTATCCTGGTCTGCATGTCCAGAAAAGGAGTCCGGCTGCACGGTTCACAGCGATCATTGTTCAGGCTGCTGTTTGTTCCCATTTTGCCCGATGACGACTGACGACGAGGATTCGCTGACCCAAAACGCATCCACAAGGCTGAGCACTGTGAGCACTGGGCTTTTCCAAGGGCAGGAACAGCTCTCATTTCTCCGGAAGTTTCTCCGGAAGTCAGCAGTCAGTAGTTTAGGCTGCGTTTCTTTTTATAT

Full Affymetrix probeset data:

Annotations for 1637037_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime