FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637038_at:

>probe:Drosophila_2:1637038_at:362:1; Interrogation_Position=1048; Antisense; ATGGTAAAGACCACCCTGTTTGCTT
>probe:Drosophila_2:1637038_at:294:9; Interrogation_Position=501; Antisense; ATTCGCGTGGAGGAGCCGTTCAGCT
>probe:Drosophila_2:1637038_at:314:601; Interrogation_Position=565; Antisense; TGTTCTTCCTAACCAACGGACTCGG
>probe:Drosophila_2:1637038_at:134:405; Interrogation_Position=583; Antisense; GACTCGGCTGCATGCATATCCTCAG
>probe:Drosophila_2:1637038_at:272:499; Interrogation_Position=616; Antisense; GTCTCGAGCACCAGATGACCCTGAA
>probe:Drosophila_2:1637038_at:625:343; Interrogation_Position=658; Antisense; GCATTTGCATTGAGTTCGGACCCAC
>probe:Drosophila_2:1637038_at:140:139; Interrogation_Position=681; Antisense; ACGGGTAAATACTTTGCCACTGGCT
>probe:Drosophila_2:1637038_at:70:219; Interrogation_Position=718; Antisense; AAGTCTCCTTGTGGGATGCCAACGA
>probe:Drosophila_2:1637038_at:547:353; Interrogation_Position=787; Antisense; GCACCATATCGTTTAGCCACGACGA
>probe:Drosophila_2:1637038_at:574:231; Interrogation_Position=815; Antisense; AATGATTGCCTTGGCCAGCGAGGAC
>probe:Drosophila_2:1637038_at:615:13; Interrogation_Position=843; Antisense; ATTATCGACATTGCCTTCACGGAGA
>probe:Drosophila_2:1637038_at:511:289; Interrogation_Position=875; Antisense; GCGGGTAACCGACATTCACGTGGAC
>probe:Drosophila_2:1637038_at:95:523; Interrogation_Position=915; Antisense; GTGGCCTGGCATCCGAAGCAGTACC
>probe:Drosophila_2:1637038_at:212:139; Interrogation_Position=970; Antisense; ACGATCGGCGACGTGACGCTGGCAA

Paste this into a BLAST search page for me
ATGGTAAAGACCACCCTGTTTGCTTATTCGCGTGGAGGAGCCGTTCAGCTTGTTCTTCCTAACCAACGGACTCGGGACTCGGCTGCATGCATATCCTCAGGTCTCGAGCACCAGATGACCCTGAAGCATTTGCATTGAGTTCGGACCCACACGGGTAAATACTTTGCCACTGGCTAAGTCTCCTTGTGGGATGCCAACGAGCACCATATCGTTTAGCCACGACGAAATGATTGCCTTGGCCAGCGAGGACATTATCGACATTGCCTTCACGGAGAGCGGGTAACCGACATTCACGTGGACGTGGCCTGGCATCCGAAGCAGTACCACGATCGGCGACGTGACGCTGGCAA

Full Affymetrix probeset data:

Annotations for 1637038_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720