FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637039_at:

>probe:Drosophila_2:1637039_at:402:229; Interrogation_Position=4744; Antisense; AATGTTTGTCCGCTTATGTTCCTTA
>probe:Drosophila_2:1637039_at:178:353; Interrogation_Position=4905; Antisense; GCAGCTGTGGTCAACACTGTACACT
>probe:Drosophila_2:1637039_at:487:155; Interrogation_Position=4925; Antisense; ACACTGGTGTAATCTAAGCCTTTCA
>probe:Drosophila_2:1637039_at:493:703; Interrogation_Position=4970; Antisense; TTATCATCTATGTCTTGGCGGCTTG
>probe:Drosophila_2:1637039_at:47:635; Interrogation_Position=4995; Antisense; TCGCACCTTATCCTCAAATTCGTAG
>probe:Drosophila_2:1637039_at:559:245; Interrogation_Position=5011; Antisense; AATTCGTAGGCACCCATAGACCAGA
>probe:Drosophila_2:1637039_at:574:103; Interrogation_Position=5028; Antisense; AGACCAGATCAGGTTGGCGTCCGTC
>probe:Drosophila_2:1637039_at:557:409; Interrogation_Position=5061; Antisense; GACGAACTCGGTCGCATAGGTGTTT
>probe:Drosophila_2:1637039_at:272:513; Interrogation_Position=5080; Antisense; GTGTTTGAGGTGCTTACCATACCAC
>probe:Drosophila_2:1637039_at:722:177; Interrogation_Position=5106; Antisense; AAACTCCAGCTGTGCATGATCTAGA
>probe:Drosophila_2:1637039_at:6:151; Interrogation_Position=5183; Antisense; ACATAGGTTCCATTTGAGTCCCGTG
>probe:Drosophila_2:1637039_at:369:679; Interrogation_Position=5209; Antisense; TAGTGACATTGTGGGCCGACGATCC
>probe:Drosophila_2:1637039_at:569:35; Interrogation_Position=5241; Antisense; ATCAGAGAGCACCATCGCTGGCTGG
>probe:Drosophila_2:1637039_at:532:71; Interrogation_Position=5271; Antisense; AGGTCGACGGGCACCTGTATCGTGT

Paste this into a BLAST search page for me
AATGTTTGTCCGCTTATGTTCCTTAGCAGCTGTGGTCAACACTGTACACTACACTGGTGTAATCTAAGCCTTTCATTATCATCTATGTCTTGGCGGCTTGTCGCACCTTATCCTCAAATTCGTAGAATTCGTAGGCACCCATAGACCAGAAGACCAGATCAGGTTGGCGTCCGTCGACGAACTCGGTCGCATAGGTGTTTGTGTTTGAGGTGCTTACCATACCACAAACTCCAGCTGTGCATGATCTAGAACATAGGTTCCATTTGAGTCCCGTGTAGTGACATTGTGGGCCGACGATCCATCAGAGAGCACCATCGCTGGCTGGAGGTCGACGGGCACCTGTATCGTGT

Full Affymetrix probeset data:

Annotations for 1637039_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720