FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637043_at:

>probe:Drosophila_2:1637043_at:375:327; Interrogation_Position=1002; Antisense; GCGATTGGAGGAGGTTCTCTCTACA
>probe:Drosophila_2:1637043_at:228:279; Interrogation_Position=1020; Antisense; CTCTACATCTTTGTGGCAACTCGGA
>probe:Drosophila_2:1637043_at:681:163; Interrogation_Position=1044; Antisense; AAATTTGCACGCATTTCAACTCGGA
>probe:Drosophila_2:1637043_at:224:401; Interrogation_Position=1144; Antisense; GACATTGGCCGTGTTAGAAGCCTAC
>probe:Drosophila_2:1637043_at:384:661; Interrogation_Position=1158; Antisense; TAGAAGCCTACATACCGCGGTTTTT
>probe:Drosophila_2:1637043_at:148:699; Interrogation_Position=1181; Antisense; TTTACCGACGCCACAAAAGTCTACT
>probe:Drosophila_2:1637043_at:105:61; Interrogation_Position=1236; Antisense; ATGTTTCGCATGACACTCATCTGGA
>probe:Drosophila_2:1637043_at:161:419; Interrogation_Position=1285; Antisense; GAGCAGTTTCTCCTTCGAAATCGAA
>probe:Drosophila_2:1637043_at:575:477; Interrogation_Position=1318; Antisense; GTTTATCAAGCAGCGACTCTACAAA
>probe:Drosophila_2:1637043_at:677:605; Interrogation_Position=864; Antisense; TGATCTTCGCCCAGAGCTTGTTGCG
>probe:Drosophila_2:1637043_at:570:469; Interrogation_Position=883; Antisense; GTTGCGCAATCCCAATAAGCCGATG
>probe:Drosophila_2:1637043_at:478:395; Interrogation_Position=916; Antisense; GAAATTCTTCGACACCAACTTCAAT
>probe:Drosophila_2:1637043_at:151:9; Interrogation_Position=942; Antisense; ATTGCGTCAGAAAGCGGGTGCGCCC
>probe:Drosophila_2:1637043_at:169:507; Interrogation_Position=959; Antisense; GTGCGCCCGCATTGTGTTTTCGACG

Paste this into a BLAST search page for me
GCGATTGGAGGAGGTTCTCTCTACACTCTACATCTTTGTGGCAACTCGGAAAATTTGCACGCATTTCAACTCGGAGACATTGGCCGTGTTAGAAGCCTACTAGAAGCCTACATACCGCGGTTTTTTTTACCGACGCCACAAAAGTCTACTATGTTTCGCATGACACTCATCTGGAGAGCAGTTTCTCCTTCGAAATCGAAGTTTATCAAGCAGCGACTCTACAAATGATCTTCGCCCAGAGCTTGTTGCGGTTGCGCAATCCCAATAAGCCGATGGAAATTCTTCGACACCAACTTCAATATTGCGTCAGAAAGCGGGTGCGCCCGTGCGCCCGCATTGTGTTTTCGACG

Full Affymetrix probeset data:

Annotations for 1637043_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720