Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637046_at:

>probe:Drosophila_2:1637046_at:618:153; Interrogation_Position=3477; Antisense; ACAGATGGGTCTGCACGATCTGCGC
>probe:Drosophila_2:1637046_at:145:625; Interrogation_Position=3497; Antisense; TGCGCCGACAGATCTCGATTATACC
>probe:Drosophila_2:1637046_at:381:459; Interrogation_Position=3513; Antisense; GATTATACCCCAAGAGCCTGTGCTA
>probe:Drosophila_2:1637046_at:272:689; Interrogation_Position=3536; Antisense; TATTCTCCGGTACCATGCGATACAA
>probe:Drosophila_2:1637046_at:556:259; Interrogation_Position=3669; Antisense; CAGCGAGGGCGGAACCAATTTCAGT
>probe:Drosophila_2:1637046_at:612:249; Interrogation_Position=3684; Antisense; CAATTTCAGTGTGGGTCAGCGCCAG
>probe:Drosophila_2:1637046_at:245:295; Interrogation_Position=3736; Antisense; CGAGAGAATCGCATCCTTGTTATGG
>probe:Drosophila_2:1637046_at:528:519; Interrogation_Position=3778; Antisense; GTGGATCCTCAAACGGATGGCCTCA
>probe:Drosophila_2:1637046_at:380:721; Interrogation_Position=3834; Antisense; TTGCACTGTTTTGACAATAGCCCAT
>probe:Drosophila_2:1637046_at:715:513; Interrogation_Position=3911; Antisense; GTGTTGTGGAGTTTGGATCGCCCTA
>probe:Drosophila_2:1637046_at:117:451; Interrogation_Position=3926; Antisense; GATCGCCCTATGAACTGATGACCAA
>probe:Drosophila_2:1637046_at:583:289; Interrogation_Position=3953; Antisense; CGGATTCCAAGGTATTCCACAACTT
>probe:Drosophila_2:1637046_at:461:149; Interrogation_Position=3974; Antisense; ACTTGGTCAATCAGTCGGGTCGAGC
>probe:Drosophila_2:1637046_at:182:501; Interrogation_Position=3992; Antisense; GTCGAGCCAGCTACGAGGGACTGCT

Paste this into a BLAST search page for me
ACAGATGGGTCTGCACGATCTGCGCTGCGCCGACAGATCTCGATTATACCGATTATACCCCAAGAGCCTGTGCTATATTCTCCGGTACCATGCGATACAACAGCGAGGGCGGAACCAATTTCAGTCAATTTCAGTGTGGGTCAGCGCCAGCGAGAGAATCGCATCCTTGTTATGGGTGGATCCTCAAACGGATGGCCTCATTGCACTGTTTTGACAATAGCCCATGTGTTGTGGAGTTTGGATCGCCCTAGATCGCCCTATGAACTGATGACCAACGGATTCCAAGGTATTCCACAACTTACTTGGTCAATCAGTCGGGTCGAGCGTCGAGCCAGCTACGAGGGACTGCT

Full Affymetrix probeset data:

Annotations for 1637046_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime