Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637049_at:

>probe:Drosophila_2:1637049_at:594:23; Interrogation_Position=3475; Antisense; ATATCGGACGATTTGGACCCTAGAC
>probe:Drosophila_2:1637049_at:93:279; Interrogation_Position=3494; Antisense; CTAGACTATAGGCATTTGTAGCATA
>probe:Drosophila_2:1637049_at:68:23; Interrogation_Position=3518; Antisense; ATATAGTGTGTATTCCTCTCTCGTT
>probe:Drosophila_2:1637049_at:581:481; Interrogation_Position=3527; Antisense; GTATTCCTCTCTCGTTGCGAACTCA
>probe:Drosophila_2:1637049_at:700:721; Interrogation_Position=3541; Antisense; TTGCGAACTCACTCTGCCCGTTTAT
>probe:Drosophila_2:1637049_at:410:283; Interrogation_Position=3554; Antisense; CTGCCCGTTTATCGCCAGTGTTAAG
>probe:Drosophila_2:1637049_at:563:725; Interrogation_Position=3597; Antisense; TTGTCTCGTTTCTAAGCAAAGCCTA
>probe:Drosophila_2:1637049_at:620:173; Interrogation_Position=3614; Antisense; AAAGCCTAGCCCCTAGAAATCGCTG
>probe:Drosophila_2:1637049_at:607:165; Interrogation_Position=3630; Antisense; AAATCGCTGGCGATTCGCTGGCAAA
>probe:Drosophila_2:1637049_at:258:361; Interrogation_Position=3765; Antisense; GAATCGTCGTAACTTTTAGCGCCTT
>probe:Drosophila_2:1637049_at:630:705; Interrogation_Position=3780; Antisense; TTAGCGCCTTGAAGGTTCCAGACTT
>probe:Drosophila_2:1637049_at:461:539; Interrogation_Position=3793; Antisense; GGTTCCAGACTTCAAGATCAAACAG
>probe:Drosophila_2:1637049_at:353:525; Interrogation_Position=3846; Antisense; GGGCTATCCTCAGACAAATTTATGT
>probe:Drosophila_2:1637049_at:410:323; Interrogation_Position=3922; Antisense; GCGCCTCTTTATATACATCTAGAAC

Paste this into a BLAST search page for me
ATATCGGACGATTTGGACCCTAGACCTAGACTATAGGCATTTGTAGCATAATATAGTGTGTATTCCTCTCTCGTTGTATTCCTCTCTCGTTGCGAACTCATTGCGAACTCACTCTGCCCGTTTATCTGCCCGTTTATCGCCAGTGTTAAGTTGTCTCGTTTCTAAGCAAAGCCTAAAAGCCTAGCCCCTAGAAATCGCTGAAATCGCTGGCGATTCGCTGGCAAAGAATCGTCGTAACTTTTAGCGCCTTTTAGCGCCTTGAAGGTTCCAGACTTGGTTCCAGACTTCAAGATCAAACAGGGGCTATCCTCAGACAAATTTATGTGCGCCTCTTTATATACATCTAGAAC

Full Affymetrix probeset data:

Annotations for 1637049_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime