Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637050_at:

>probe:Drosophila_2:1637050_at:389:317; Interrogation_Position=13; Antisense; GCCTGTTACACTAAGTCAGACAGAT
>probe:Drosophila_2:1637050_at:155:495; Interrogation_Position=27; Antisense; GTCAGACAGATCTAAAACCCTTATT
>probe:Drosophila_2:1637050_at:178:119; Interrogation_Position=501; Antisense; AGCGGAGTCCTCGAGGAAAATAATG
>probe:Drosophila_2:1637050_at:50:505; Interrogation_Position=507; Antisense; GTCCTCGAGGAAAATAATGGATCGT
>probe:Drosophila_2:1637050_at:389:661; Interrogation_Position=52; Antisense; TAAACTAAATGTATTCTCCCAAACT
>probe:Drosophila_2:1637050_at:229:535; Interrogation_Position=525; Antisense; GGATCGTTTAGTTTAATATGAGCCA
>probe:Drosophila_2:1637050_at:548:291; Interrogation_Position=529; Antisense; CGTTTAGTTTAATATGAGCCATTTA
>probe:Drosophila_2:1637050_at:654:415; Interrogation_Position=544; Antisense; GAGCCATTTACTTCATAGCAACATA
>probe:Drosophila_2:1637050_at:397:309; Interrogation_Position=546; Antisense; GCCATTTACTTCATAGCAACATAAT
>probe:Drosophila_2:1637050_at:137:345; Interrogation_Position=561; Antisense; GCAACATAATTATAAACGACCAGCT
>probe:Drosophila_2:1637050_at:166:659; Interrogation_Position=57; Antisense; TAAATGTATTCTCCCAAACTTCTAG
>probe:Drosophila_2:1637050_at:401:703; Interrogation_Position=570; Antisense; TTATAAACGACCAGCTCAACAGAAT
>probe:Drosophila_2:1637050_at:133:481; Interrogation_Position=62; Antisense; GTATTCTCCCAAACTTCTAGAACTA
>probe:Drosophila_2:1637050_at:507:177; Interrogation_Position=72; Antisense; AAACTTCTAGAACTACGTAGCGCAT

Paste this into a BLAST search page for me
GCCTGTTACACTAAGTCAGACAGATGTCAGACAGATCTAAAACCCTTATTAGCGGAGTCCTCGAGGAAAATAATGGTCCTCGAGGAAAATAATGGATCGTTAAACTAAATGTATTCTCCCAAACTGGATCGTTTAGTTTAATATGAGCCACGTTTAGTTTAATATGAGCCATTTAGAGCCATTTACTTCATAGCAACATAGCCATTTACTTCATAGCAACATAATGCAACATAATTATAAACGACCAGCTTAAATGTATTCTCCCAAACTTCTAGTTATAAACGACCAGCTCAACAGAATGTATTCTCCCAAACTTCTAGAACTAAAACTTCTAGAACTACGTAGCGCAT

Full Affymetrix probeset data:

Annotations for 1637050_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime