Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637051_at:

>probe:Drosophila_2:1637051_at:69:335; Interrogation_Position=2482; Antisense; GCTCACGCATTTCCGTTTGAGAACT
>probe:Drosophila_2:1637051_at:238:257; Interrogation_Position=2485; Antisense; CACGCATTTCCGTTTGAGAACTTGC
>probe:Drosophila_2:1637051_at:605:343; Interrogation_Position=2488; Antisense; GCATTTCCGTTTGAGAACTTGCGAT
>probe:Drosophila_2:1637051_at:666:695; Interrogation_Position=2491; Antisense; TTTCCGTTTGAGAACTTGCGATAGT
>probe:Drosophila_2:1637051_at:656:105; Interrogation_Position=2501; Antisense; AGAACTTGCGATAGTTGTGTAGAAC
>probe:Drosophila_2:1637051_at:31:457; Interrogation_Position=2510; Antisense; GATAGTTGTGTAGAACGTACCATCT
>probe:Drosophila_2:1637051_at:452:467; Interrogation_Position=2514; Antisense; GTTGTGTAGAACGTACCATCTATTA
>probe:Drosophila_2:1637051_at:329:485; Interrogation_Position=2519; Antisense; GTAGAACGTACCATCTATTATATAG
>probe:Drosophila_2:1637051_at:24:687; Interrogation_Position=2539; Antisense; TATAGATCCTAGGTCTAACCCCGTT
>probe:Drosophila_2:1637051_at:96:665; Interrogation_Position=2541; Antisense; TAGATCCTAGGTCTAACCCCGTTTG
>probe:Drosophila_2:1637051_at:20:375; Interrogation_Position=2543; Antisense; GATCCTAGGTCTAACCCCGTTTGCA
>probe:Drosophila_2:1637051_at:72:471; Interrogation_Position=2551; Antisense; GTCTAACCCCGTTTGCAAATGCTCG
>probe:Drosophila_2:1637051_at:249:51; Interrogation_Position=2569; Antisense; ATGCTCGAATTTCTTTTAAGTTTTG
>probe:Drosophila_2:1637051_at:696:209; Interrogation_Position=3002; Antisense; AAGAATCTAAGCTCCCTCACACCCT

Paste this into a BLAST search page for me
GCTCACGCATTTCCGTTTGAGAACTCACGCATTTCCGTTTGAGAACTTGCGCATTTCCGTTTGAGAACTTGCGATTTTCCGTTTGAGAACTTGCGATAGTAGAACTTGCGATAGTTGTGTAGAACGATAGTTGTGTAGAACGTACCATCTGTTGTGTAGAACGTACCATCTATTAGTAGAACGTACCATCTATTATATAGTATAGATCCTAGGTCTAACCCCGTTTAGATCCTAGGTCTAACCCCGTTTGGATCCTAGGTCTAACCCCGTTTGCAGTCTAACCCCGTTTGCAAATGCTCGATGCTCGAATTTCTTTTAAGTTTTGAAGAATCTAAGCTCCCTCACACCCT

Full Affymetrix probeset data:

Annotations for 1637051_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime