Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637053_at:

>probe:Drosophila_2:1637053_at:278:317; Interrogation_Position=2688; Antisense; GCCGTGGGTGTCACTAAGCTACTTA
>probe:Drosophila_2:1637053_at:258:359; Interrogation_Position=2735; Antisense; GCAACAGTACGCTACTTTCTGGCCA
>probe:Drosophila_2:1637053_at:128:145; Interrogation_Position=2762; Antisense; ACTGCTGCATTCTCTAATCGATCTT
>probe:Drosophila_2:1637053_at:452:453; Interrogation_Position=2781; Antisense; GATCTTTTTGAACGACCACCAGAGA
>probe:Drosophila_2:1637053_at:165:589; Interrogation_Position=2837; Antisense; TGGAGTTGCCGAAGATCCCGATGCG
>probe:Drosophila_2:1637053_at:464:521; Interrogation_Position=2871; Antisense; GTGGCATTTGCCCAACTGACTCATG
>probe:Drosophila_2:1637053_at:204:225; Interrogation_Position=2931; Antisense; AAGGATGCTCGCCAGTTTCTAGCAA
>probe:Drosophila_2:1637053_at:55:93; Interrogation_Position=2944; Antisense; AGTTTCTAGCAACTTCGCTCTCTAA
>probe:Drosophila_2:1637053_at:35:337; Interrogation_Position=2960; Antisense; GCTCTCTAAGTTTGCCCAGGCTAGG
>probe:Drosophila_2:1637053_at:614:421; Interrogation_Position=2989; Antisense; GAGAATTTTCCACTTTGTTGTCGCC
>probe:Drosophila_2:1637053_at:213:565; Interrogation_Position=3082; Antisense; GGAATCGACCGACTTTAAGCTCATT
>probe:Drosophila_2:1637053_at:478:205; Interrogation_Position=3098; Antisense; AAGCTCATTCATCGCAATCAAACCT
>probe:Drosophila_2:1637053_at:345:699; Interrogation_Position=3140; Antisense; TTTATGCATACACGCACTCGATCAC
>probe:Drosophila_2:1637053_at:619:453; Interrogation_Position=3159; Antisense; GATCACTCATTGCATGCCCAGTTTA

Paste this into a BLAST search page for me
GCCGTGGGTGTCACTAAGCTACTTAGCAACAGTACGCTACTTTCTGGCCAACTGCTGCATTCTCTAATCGATCTTGATCTTTTTGAACGACCACCAGAGATGGAGTTGCCGAAGATCCCGATGCGGTGGCATTTGCCCAACTGACTCATGAAGGATGCTCGCCAGTTTCTAGCAAAGTTTCTAGCAACTTCGCTCTCTAAGCTCTCTAAGTTTGCCCAGGCTAGGGAGAATTTTCCACTTTGTTGTCGCCGGAATCGACCGACTTTAAGCTCATTAAGCTCATTCATCGCAATCAAACCTTTTATGCATACACGCACTCGATCACGATCACTCATTGCATGCCCAGTTTA

Full Affymetrix probeset data:

Annotations for 1637053_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime