FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637057_at:

>probe:Drosophila_2:1637057_at:99:265; Interrogation_Position=3168; Antisense; CAGCAGCATTGCGAAAACCGTAATT
>probe:Drosophila_2:1637057_at:343:697; Interrogation_Position=3202; Antisense; TTTAAGCCACGTTGCGAAATCGAGA
>probe:Drosophila_2:1637057_at:420:395; Interrogation_Position=3232; Antisense; GAAATCGATGACCAGGACACGCTCA
>probe:Drosophila_2:1637057_at:363:399; Interrogation_Position=3247; Antisense; GACACGCTCATTTGTACTGCATACG
>probe:Drosophila_2:1637057_at:312:439; Interrogation_Position=3283; Antisense; GAGGCAGATTTTTCTTGGTCAATTA
>probe:Drosophila_2:1637057_at:141:197; Interrogation_Position=3476; Antisense; AACTGGCATGGTGGCAACTCTGGGA
>probe:Drosophila_2:1637057_at:327:385; Interrogation_Position=3504; Antisense; GAACACTCTTATCATACTGGTTGCT
>probe:Drosophila_2:1637057_at:355:29; Interrogation_Position=3517; Antisense; ATACTGGTTGCTGCTATCTTGGGAT
>probe:Drosophila_2:1637057_at:162:25; Interrogation_Position=3532; Antisense; ATCTTGGGATTATTGCTGACCGTAA
>probe:Drosophila_2:1637057_at:343:245; Interrogation_Position=3573; Antisense; AATTATATGTATTTGCCGTCGCCGT
>probe:Drosophila_2:1637057_at:16:317; Interrogation_Position=3593; Antisense; GCCGTCGGCGCCAGGATAAATTACA
>probe:Drosophila_2:1637057_at:582:495; Interrogation_Position=3624; Antisense; GTCGTCTTCACTAAGGGAACCGTTG
>probe:Drosophila_2:1637057_at:349:377; Interrogation_Position=3640; Antisense; GAACCGTTGACGGAACCTGGCGAGT
>probe:Drosophila_2:1637057_at:712:695; Interrogation_Position=3679; Antisense; TTTCATGGTCTGCAAACGGCACCTA

Paste this into a BLAST search page for me
CAGCAGCATTGCGAAAACCGTAATTTTTAAGCCACGTTGCGAAATCGAGAGAAATCGATGACCAGGACACGCTCAGACACGCTCATTTGTACTGCATACGGAGGCAGATTTTTCTTGGTCAATTAAACTGGCATGGTGGCAACTCTGGGAGAACACTCTTATCATACTGGTTGCTATACTGGTTGCTGCTATCTTGGGATATCTTGGGATTATTGCTGACCGTAAAATTATATGTATTTGCCGTCGCCGTGCCGTCGGCGCCAGGATAAATTACAGTCGTCTTCACTAAGGGAACCGTTGGAACCGTTGACGGAACCTGGCGAGTTTTCATGGTCTGCAAACGGCACCTA

Full Affymetrix probeset data:

Annotations for 1637057_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720