FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637062_at:

>probe:Drosophila_2:1637062_at:84:199; Interrogation_Position=1055; Antisense; AACGAGGTTGTCACCATTCCGCTGA
>probe:Drosophila_2:1637062_at:703:9; Interrogation_Position=1070; Antisense; ATTCCGCTGACCATTGGCAGTGTCC
>probe:Drosophila_2:1637062_at:227:377; Interrogation_Position=1166; Antisense; GAAGAAGTAGCCACTGCTCCAAACT
>probe:Drosophila_2:1637062_at:550:619; Interrogation_Position=1180; Antisense; TGCTCCAAACTCTTCAAGTCCATGG
>probe:Drosophila_2:1637062_at:423:651; Interrogation_Position=1193; Antisense; TCAAGTCCATGGTCTGTCGACGCAT
>probe:Drosophila_2:1637062_at:683:35; Interrogation_Position=1236; Antisense; ATCAGGAGGCTGTTCACATGCGCAG
>probe:Drosophila_2:1637062_at:67:265; Interrogation_Position=1258; Antisense; CAGCACGGCTGCAACGAGGTCAGAC
>probe:Drosophila_2:1637062_at:436:491; Interrogation_Position=1276; Antisense; GTCAGACGACTTAGACGACCCGGAA
>probe:Drosophila_2:1637062_at:507:673; Interrogation_Position=1305; Antisense; TACCGCCCAATACTCTCAGTTTGGA
>probe:Drosophila_2:1637062_at:482:507; Interrogation_Position=1335; Antisense; GTGCTTATAAGCCACTCTATCCGGT
>probe:Drosophila_2:1637062_at:226:319; Interrogation_Position=1387; Antisense; GCCGCCGACGGATTATACGCAGAAT
>probe:Drosophila_2:1637062_at:497:351; Interrogation_Position=1418; Antisense; GCAGAGAGGGCCTTTGTCAATCCGG
>probe:Drosophila_2:1637062_at:361:117; Interrogation_Position=944; Antisense; AGCTATGAGATCAGAGTCCCGGCCA
>probe:Drosophila_2:1637062_at:123:203; Interrogation_Position=986; Antisense; AACCTGTGCGGCATCATCCAGATCG

Paste this into a BLAST search page for me
AACGAGGTTGTCACCATTCCGCTGAATTCCGCTGACCATTGGCAGTGTCCGAAGAAGTAGCCACTGCTCCAAACTTGCTCCAAACTCTTCAAGTCCATGGTCAAGTCCATGGTCTGTCGACGCATATCAGGAGGCTGTTCACATGCGCAGCAGCACGGCTGCAACGAGGTCAGACGTCAGACGACTTAGACGACCCGGAATACCGCCCAATACTCTCAGTTTGGAGTGCTTATAAGCCACTCTATCCGGTGCCGCCGACGGATTATACGCAGAATGCAGAGAGGGCCTTTGTCAATCCGGAGCTATGAGATCAGAGTCCCGGCCAAACCTGTGCGGCATCATCCAGATCG

Full Affymetrix probeset data:

Annotations for 1637062_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720