FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637063_at:

>probe:Drosophila_2:1637063_at:79:559; Interrogation_Position=1039; Antisense; GGACAAAGTATACAGCGCCTATGAA
>probe:Drosophila_2:1637063_at:109:671; Interrogation_Position=1091; Antisense; TACGGTCAGCGATCTCAATAAGTCA
>probe:Drosophila_2:1637063_at:397:171; Interrogation_Position=1130; Antisense; AAAGTTTATTACAGCTCTAGCCATA
>probe:Drosophila_2:1637063_at:128:447; Interrogation_Position=661; Antisense; GATGCTCTACTATCCGGCGATTGTG
>probe:Drosophila_2:1637063_at:521:81; Interrogation_Position=708; Antisense; AGGGTGCCATCCGTTGTGGTGCCCA
>probe:Drosophila_2:1637063_at:335:593; Interrogation_Position=722; Antisense; TGTGGTGCCCATGTGGACTACGGCA
>probe:Drosophila_2:1637063_at:19:583; Interrogation_Position=759; Antisense; TCGCCCAGGATTCCGAAGGTGGCTT
>probe:Drosophila_2:1637063_at:544:517; Interrogation_Position=821; Antisense; GTGGGTCATTTACCTGGTGCCATAC
>probe:Drosophila_2:1637063_at:618:525; Interrogation_Position=858; Antisense; GGGAACTTCTGTCCATCTGGACGAA
>probe:Drosophila_2:1637063_at:568:43; Interrogation_Position=906; Antisense; ATCGCGTCGTCATACCTGAACAAGA
>probe:Drosophila_2:1637063_at:49:107; Interrogation_Position=928; Antisense; AGAACTTATAAGAACCCGTGGCAGA
>probe:Drosophila_2:1637063_at:378:291; Interrogation_Position=944; Antisense; CGTGGCAGACACTCCATAGCATATT
>probe:Drosophila_2:1637063_at:270:27; Interrogation_Position=959; Antisense; ATAGCATATTTCTGCCATCCCAATA
>probe:Drosophila_2:1637063_at:453:661; Interrogation_Position=982; Antisense; TAACTCGATCTTGATATCTCCCAAC

Paste this into a BLAST search page for me
GGACAAAGTATACAGCGCCTATGAATACGGTCAGCGATCTCAATAAGTCAAAAGTTTATTACAGCTCTAGCCATAGATGCTCTACTATCCGGCGATTGTGAGGGTGCCATCCGTTGTGGTGCCCATGTGGTGCCCATGTGGACTACGGCATCGCCCAGGATTCCGAAGGTGGCTTGTGGGTCATTTACCTGGTGCCATACGGGAACTTCTGTCCATCTGGACGAAATCGCGTCGTCATACCTGAACAAGAAGAACTTATAAGAACCCGTGGCAGACGTGGCAGACACTCCATAGCATATTATAGCATATTTCTGCCATCCCAATATAACTCGATCTTGATATCTCCCAAC

Full Affymetrix probeset data:

Annotations for 1637063_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720