FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637064_at:

>probe:Drosophila_2:1637064_at:434:429; Interrogation_Position=521; Antisense; GAGTTTGCCATCGACGACAGTCTGT
>probe:Drosophila_2:1637064_at:292:401; Interrogation_Position=536; Antisense; GACAGTCTGTTGGTGAGGCGCATCA
>probe:Drosophila_2:1637064_at:383:715; Interrogation_Position=592; Antisense; TTCGTATCACGAAGAGTTTGCCCCT
>probe:Drosophila_2:1637064_at:475:693; Interrogation_Position=608; Antisense; TTTGCCCCTCCAAAGAAGCCAATGA
>probe:Drosophila_2:1637064_at:443:409; Interrogation_Position=635; Antisense; GACGATGTCACTGGAGAGCCCCTAA
>probe:Drosophila_2:1637064_at:490:103; Interrogation_Position=720; Antisense; AGACAAAGCCGCTGGTCGACTACTA
>probe:Drosophila_2:1637064_at:145:43; Interrogation_Position=809; Antisense; ATCGACTCTATATTCCAACGCAAGC
>probe:Drosophila_2:1637064_at:305:505; Interrogation_Position=834; Antisense; GTCCTGCCCAGATCCAGTTATGATT
>probe:Drosophila_2:1637064_at:272:93; Interrogation_Position=849; Antisense; AGTTATGATTTGTTCCTGCGCAATG
>probe:Drosophila_2:1637064_at:61:455; Interrogation_Position=873; Antisense; GATCAACTACTGATAACTGCCTCCT
>probe:Drosophila_2:1637064_at:324:145; Interrogation_Position=888; Antisense; ACTGCCTCCTGACAATTTATTTCGA
>probe:Drosophila_2:1637064_at:713:423; Interrogation_Position=911; Antisense; GAGACACACACAACGTTTAAGCCTA
>probe:Drosophila_2:1637064_at:230:477; Interrogation_Position=938; Antisense; GTTATAGTTGCATCCGGAAATCCTG
>probe:Drosophila_2:1637064_at:471:535; Interrogation_Position=985; Antisense; GGTCGACTACTTTCCTTGTACAGAT

Paste this into a BLAST search page for me
GAGTTTGCCATCGACGACAGTCTGTGACAGTCTGTTGGTGAGGCGCATCATTCGTATCACGAAGAGTTTGCCCCTTTTGCCCCTCCAAAGAAGCCAATGAGACGATGTCACTGGAGAGCCCCTAAAGACAAAGCCGCTGGTCGACTACTAATCGACTCTATATTCCAACGCAAGCGTCCTGCCCAGATCCAGTTATGATTAGTTATGATTTGTTCCTGCGCAATGGATCAACTACTGATAACTGCCTCCTACTGCCTCCTGACAATTTATTTCGAGAGACACACACAACGTTTAAGCCTAGTTATAGTTGCATCCGGAAATCCTGGGTCGACTACTTTCCTTGTACAGAT

Full Affymetrix probeset data:

Annotations for 1637064_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720