FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637066_at:

>probe:Drosophila_2:1637066_at:384:417; Interrogation_Position=1000; Antisense; GAGCGCTATCCAAAAGGTGTTCCCC
>probe:Drosophila_2:1637066_at:423:223; Interrogation_Position=1013; Antisense; AAGGTGTTCCCCAATGATTTAGCGG
>probe:Drosophila_2:1637066_at:170:605; Interrogation_Position=1027; Antisense; TGATTTAGCGGATGGTGGCACCTAC
>probe:Drosophila_2:1637066_at:390:441; Interrogation_Position=1037; Antisense; GATGGTGGCACCTACTTGCGAGGCC
>probe:Drosophila_2:1637066_at:150:577; Interrogation_Position=1058; Antisense; GGCCTTCCCATTCCAAAAGTGCAAG
>probe:Drosophila_2:1637066_at:338:467; Interrogation_Position=1099; Antisense; GTTGGATTCACTAGATGTTCATGCT
>probe:Drosophila_2:1637066_at:336:687; Interrogation_Position=1139; Antisense; TATATAATCCACACGAAAGTCGGTG
>probe:Drosophila_2:1637066_at:456:725; Interrogation_Position=1199; Antisense; TTGATAAATGGACTTCCGCTGAAGT
>probe:Drosophila_2:1637066_at:398:51; Interrogation_Position=1360; Antisense; ATGCGCACGATTATTCATTATTACG
>probe:Drosophila_2:1637066_at:675:229; Interrogation_Position=913; Antisense; AATGGGTAGCTATCATGCCGCGTAC
>probe:Drosophila_2:1637066_at:321:491; Interrogation_Position=934; Antisense; GTACACCTTCGATGCTGGTCCAAAT
>probe:Drosophila_2:1637066_at:408:591; Interrogation_Position=949; Antisense; TGGTCCAAATGCATGCCTCTATGTC
>probe:Drosophila_2:1637066_at:531:49; Interrogation_Position=961; Antisense; ATGCCTCTATGTCCTGGCGGAGCAC
>probe:Drosophila_2:1637066_at:305:139; Interrogation_Position=984; Antisense; ACGTTCCGCATCTCTTGAGCGCTAT

Paste this into a BLAST search page for me
GAGCGCTATCCAAAAGGTGTTCCCCAAGGTGTTCCCCAATGATTTAGCGGTGATTTAGCGGATGGTGGCACCTACGATGGTGGCACCTACTTGCGAGGCCGGCCTTCCCATTCCAAAAGTGCAAGGTTGGATTCACTAGATGTTCATGCTTATATAATCCACACGAAAGTCGGTGTTGATAAATGGACTTCCGCTGAAGTATGCGCACGATTATTCATTATTACGAATGGGTAGCTATCATGCCGCGTACGTACACCTTCGATGCTGGTCCAAATTGGTCCAAATGCATGCCTCTATGTCATGCCTCTATGTCCTGGCGGAGCACACGTTCCGCATCTCTTGAGCGCTAT

Full Affymetrix probeset data:

Annotations for 1637066_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720