FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637067_at:

>probe:Drosophila_2:1637067_at:493:529; Interrogation_Position=466; Antisense; GGGATCCGAGCATGTCATTAACGAC
>probe:Drosophila_2:1637067_at:19:657; Interrogation_Position=484; Antisense; TAACGACATCCGCTACACCATGGAG
>probe:Drosophila_2:1637067_at:329:303; Interrogation_Position=523; Antisense; CCGGAACAAGAAGTACGCGACCATT
>probe:Drosophila_2:1637067_at:479:439; Interrogation_Position=551; Antisense; GAGGCTCTCAATCATCCGGATGGTG
>probe:Drosophila_2:1637067_at:710:475; Interrogation_Position=588; Antisense; GTTTCTTCTTCAATCTCGACGAGGA
>probe:Drosophila_2:1637067_at:3:81; Interrogation_Position=615; Antisense; AGGGTGCTGGCCTGGTGACCATTAA
>probe:Drosophila_2:1637067_at:601:413; Interrogation_Position=631; Antisense; GACCATTAACCGACATTTGCATCTG
>probe:Drosophila_2:1637067_at:655:441; Interrogation_Position=725; Antisense; GATGTGGACAAGTTCTACACGTACA
>probe:Drosophila_2:1637067_at:97:549; Interrogation_Position=778; Antisense; GGAGGCCGTCACCTGGATACTGTTT
>probe:Drosophila_2:1637067_at:481:463; Interrogation_Position=840; Antisense; GATTCCGTCAGCTGTCGGACACGCA
>probe:Drosophila_2:1637067_at:50:533; Interrogation_Position=877; Antisense; GGTGGACAATTTCAGGACCCTGCAG
>probe:Drosophila_2:1637067_at:532:125; Interrogation_Position=900; Antisense; AGCCGGTGGGCAATCGCAGGATCTT
>probe:Drosophila_2:1637067_at:306:651; Interrogation_Position=946; Antisense; TCACACCTCGATTGCCACATTGAAG
>probe:Drosophila_2:1637067_at:265:575; Interrogation_Position=977; Antisense; GGCGAATATCTCAAGTACGACTGGT

Paste this into a BLAST search page for me
GGGATCCGAGCATGTCATTAACGACTAACGACATCCGCTACACCATGGAGCCGGAACAAGAAGTACGCGACCATTGAGGCTCTCAATCATCCGGATGGTGGTTTCTTCTTCAATCTCGACGAGGAAGGGTGCTGGCCTGGTGACCATTAAGACCATTAACCGACATTTGCATCTGGATGTGGACAAGTTCTACACGTACAGGAGGCCGTCACCTGGATACTGTTTGATTCCGTCAGCTGTCGGACACGCAGGTGGACAATTTCAGGACCCTGCAGAGCCGGTGGGCAATCGCAGGATCTTTCACACCTCGATTGCCACATTGAAGGGCGAATATCTCAAGTACGACTGGT

Full Affymetrix probeset data:

Annotations for 1637067_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720