FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637068_at:

>probe:Drosophila_2:1637068_at:156:311; Interrogation_Position=2580; Antisense; GCCACGCAGTTACGGAAATCGCTTT
>probe:Drosophila_2:1637068_at:294:45; Interrogation_Position=2597; Antisense; ATCGCTTTGTGATTGGACGCTACCG
>probe:Drosophila_2:1637068_at:336:585; Interrogation_Position=2610; Antisense; TGGACGCTACCGTAATCGCCGAACT
>probe:Drosophila_2:1637068_at:405:41; Interrogation_Position=2670; Antisense; ATCGCCCATTTTGAAACGCCGATCG
>probe:Drosophila_2:1637068_at:560:87; Interrogation_Position=2779; Antisense; AGTCGGAGTCCTCGACGCTTTCAGT
>probe:Drosophila_2:1637068_at:340:711; Interrogation_Position=2798; Antisense; TTCAGTCTCGCTACATGCCGAGGGA
>probe:Drosophila_2:1637068_at:43:81; Interrogation_Position=2818; Antisense; AGGGATCGTGGCTCCGTGAATCGAA
>probe:Drosophila_2:1637068_at:494:635; Interrogation_Position=2838; Antisense; TCGAAGCAGGTACTCCTGGCACAAT
>probe:Drosophila_2:1637068_at:693:565; Interrogation_Position=2855; Antisense; GGCACAATCCCCATAAACGCAGTGT
>probe:Drosophila_2:1637068_at:26:201; Interrogation_Position=2870; Antisense; AACGCAGTGTATCACGCACCGTGGA
>probe:Drosophila_2:1637068_at:525:443; Interrogation_Position=2908; Antisense; GATGAAAGGGCAGCTACTCCGCCGA
>probe:Drosophila_2:1637068_at:637:405; Interrogation_Position=2922; Antisense; TACTCCGCCGAAAAAGGGTGTTGCT
>probe:Drosophila_2:1637068_at:698:629; Interrogation_Position=2988; Antisense; TCGCCTACGAGTCTTAAGTTTCCTT
>probe:Drosophila_2:1637068_at:372:199; Interrogation_Position=3055; Antisense; AACGCTCCCTTTGGGAATTGTTCAT

Paste this into a BLAST search page for me
GCCACGCAGTTACGGAAATCGCTTTATCGCTTTGTGATTGGACGCTACCGTGGACGCTACCGTAATCGCCGAACTATCGCCCATTTTGAAACGCCGATCGAGTCGGAGTCCTCGACGCTTTCAGTTTCAGTCTCGCTACATGCCGAGGGAAGGGATCGTGGCTCCGTGAATCGAATCGAAGCAGGTACTCCTGGCACAATGGCACAATCCCCATAAACGCAGTGTAACGCAGTGTATCACGCACCGTGGAGATGAAAGGGCAGCTACTCCGCCGATACTCCGCCGAAAAAGGGTGTTGCTTCGCCTACGAGTCTTAAGTTTCCTTAACGCTCCCTTTGGGAATTGTTCAT

Full Affymetrix probeset data:

Annotations for 1637068_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720