Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637069_at:

>probe:Drosophila_2:1637069_at:113:131; Interrogation_Position=1328; Antisense; ACCTCCGCCCGAAGAGTGCGAAGAT
>probe:Drosophila_2:1637069_at:584:99; Interrogation_Position=1349; Antisense; AGATGGCGAACTGACAGCGCGCTCG
>probe:Drosophila_2:1637069_at:337:213; Interrogation_Position=1423; Antisense; AAGAGCTGGATGTTAATGCGTCGCA
>probe:Drosophila_2:1637069_at:384:131; Interrogation_Position=1479; Antisense; ACCGACCTGGATGACACGTCTGAGA
>probe:Drosophila_2:1637069_at:29:105; Interrogation_Position=1501; Antisense; AGACGGAGGTTGGTCCATCTGCTGC
>probe:Drosophila_2:1637069_at:176:271; Interrogation_Position=1516; Antisense; CATCTGCTGCCGAGTCCGGAAATAA
>probe:Drosophila_2:1637069_at:715:239; Interrogation_Position=1536; Antisense; AATAATGAGCAGTCCCGATCAGCAC
>probe:Drosophila_2:1637069_at:537:403; Interrogation_Position=1565; Antisense; GACTCCCTTTAAGGCGTCTTATGAG
>probe:Drosophila_2:1637069_at:437:57; Interrogation_Position=1585; Antisense; ATGAGGGCACGCCTTTGCTGAAATT
>probe:Drosophila_2:1637069_at:520:719; Interrogation_Position=1599; Antisense; TTGCTGAAATTCTCCGTTTACGACA
>probe:Drosophila_2:1637069_at:613:477; Interrogation_Position=1614; Antisense; GTTTACGACAGACTGCCTGTGGGCA
>probe:Drosophila_2:1637069_at:182:595; Interrogation_Position=1651; Antisense; TGGGCGTCAGCGATGTGATCAACTT
>probe:Drosophila_2:1637069_at:242:605; Interrogation_Position=1666; Antisense; TGATCAACTTTGAAAACCTGCCCGA
>probe:Drosophila_2:1637069_at:199:363; Interrogation_Position=1789; Antisense; GCAATACAAACCACATCAATTCCCG

Paste this into a BLAST search page for me
ACCTCCGCCCGAAGAGTGCGAAGATAGATGGCGAACTGACAGCGCGCTCGAAGAGCTGGATGTTAATGCGTCGCAACCGACCTGGATGACACGTCTGAGAAGACGGAGGTTGGTCCATCTGCTGCCATCTGCTGCCGAGTCCGGAAATAAAATAATGAGCAGTCCCGATCAGCACGACTCCCTTTAAGGCGTCTTATGAGATGAGGGCACGCCTTTGCTGAAATTTTGCTGAAATTCTCCGTTTACGACAGTTTACGACAGACTGCCTGTGGGCATGGGCGTCAGCGATGTGATCAACTTTGATCAACTTTGAAAACCTGCCCGAGCAATACAAACCACATCAATTCCCG

Full Affymetrix probeset data:

Annotations for 1637069_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime