FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637070_at:

>probe:Drosophila_2:1637070_at:7:593; Interrogation_Position=241; Antisense; TGGTGGCTCCACTGAGCATTCCGGT
>probe:Drosophila_2:1637070_at:522:1; Interrogation_Position=285; Antisense; AGTTCGCCGGAATCGCCAAAGTCCT
>probe:Drosophila_2:1637070_at:288:631; Interrogation_Position=309; Antisense; TCCGGCCAGGGATCCGTTCATGATC
>probe:Drosophila_2:1637070_at:685:55; Interrogation_Position=328; Antisense; ATGATCCGCGGTCCAATTCGGTGGC
>probe:Drosophila_2:1637070_at:248:117; Interrogation_Position=376; Antisense; AGCATTCGGCGGCACTTTTGCAATC
>probe:Drosophila_2:1637070_at:240:119; Interrogation_Position=413; Antisense; AGCTGCTGCAGGCTTGGCTTTTCCG
>probe:Drosophila_2:1637070_at:557:259; Interrogation_Position=531; Antisense; CACGAGGCTCAGGACATGACCATGA
>probe:Drosophila_2:1637070_at:529:127; Interrogation_Position=549; Antisense; ACCATGAATGGTCTGGGCCCCGGCT
>probe:Drosophila_2:1637070_at:343:33; Interrogation_Position=614; Antisense; ATCATCGGCCGCTCTTTTGGATCTG
>probe:Drosophila_2:1637070_at:225:643; Interrogation_Position=626; Antisense; TCTTTTGGATCTGGCCGAATCGGCA
>probe:Drosophila_2:1637070_at:370:367; Interrogation_Position=642; Antisense; GAATCGGCAGTTGCATATCAGCAGC
>probe:Drosophila_2:1637070_at:235:523; Interrogation_Position=737; Antisense; GGGCTCTCCAGGATCAGGAGCGATT
>probe:Drosophila_2:1637070_at:155:417; Interrogation_Position=754; Antisense; GAGCGATTGCAGGATCGGGTTCATT
>probe:Drosophila_2:1637070_at:590:613; Interrogation_Position=778; Antisense; TGAATGGAAACGTGGTGCTGACCAA

Paste this into a BLAST search page for me
TGGTGGCTCCACTGAGCATTCCGGTAGTTCGCCGGAATCGCCAAAGTCCTTCCGGCCAGGGATCCGTTCATGATCATGATCCGCGGTCCAATTCGGTGGCAGCATTCGGCGGCACTTTTGCAATCAGCTGCTGCAGGCTTGGCTTTTCCGCACGAGGCTCAGGACATGACCATGAACCATGAATGGTCTGGGCCCCGGCTATCATCGGCCGCTCTTTTGGATCTGTCTTTTGGATCTGGCCGAATCGGCAGAATCGGCAGTTGCATATCAGCAGCGGGCTCTCCAGGATCAGGAGCGATTGAGCGATTGCAGGATCGGGTTCATTTGAATGGAAACGTGGTGCTGACCAA

Full Affymetrix probeset data:

Annotations for 1637070_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720