Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637071_at:

>probe:Drosophila_2:1637071_at:131:643; Interrogation_Position=2579; Antisense; TCTCGCCACAACTTCAGCTAAATGG
>probe:Drosophila_2:1637071_at:198:445; Interrogation_Position=2643; Antisense; GATGATGGTGACTTCTTCTACCACG
>probe:Drosophila_2:1637071_at:569:197; Interrogation_Position=2670; Antisense; AACGGTGATCAGCTTCAACGGCAGT
>probe:Drosophila_2:1637071_at:608:625; Interrogation_Position=2747; Antisense; TGCCTCAGCCGCAATCGAATACGAG
>probe:Drosophila_2:1637071_at:447:561; Interrogation_Position=2802; Antisense; GGAAAACCCATTGCATGCCGAATTA
>probe:Drosophila_2:1637071_at:346:241; Interrogation_Position=2833; Antisense; AATAACAACTTTTACTGCCCACACA
>probe:Drosophila_2:1637071_at:94:155; Interrogation_Position=2855; Antisense; ACAGCGAGCCCTTAAAGCGCAAGGT
>probe:Drosophila_2:1637071_at:527:685; Interrogation_Position=2879; Antisense; TATACAAGGGTAGCTCATCGTTCGA
>probe:Drosophila_2:1637071_at:233:243; Interrogation_Position=2973; Antisense; AATTAAGCTTTTGGCCTCCGTGTCG
>probe:Drosophila_2:1637071_at:560:515; Interrogation_Position=2992; Antisense; GTGTCGGCCAAGAGCTCTATGCAAG
>probe:Drosophila_2:1637071_at:22:213; Interrogation_Position=3014; Antisense; AAGACGTGACCGTTGACGAGGCCAA
>probe:Drosophila_2:1637071_at:261:131; Interrogation_Position=3062; Antisense; ACCGCAAGCAGCAGCTCATACTGAA
>probe:Drosophila_2:1637071_at:716:129; Interrogation_Position=3088; Antisense; ACCATTTTCGATTTAAAGCGCAGCT
>probe:Drosophila_2:1637071_at:554:323; Interrogation_Position=3105; Antisense; GCGCAGCTTGGAGCATCAAAGCCAT

Paste this into a BLAST search page for me
TCTCGCCACAACTTCAGCTAAATGGGATGATGGTGACTTCTTCTACCACGAACGGTGATCAGCTTCAACGGCAGTTGCCTCAGCCGCAATCGAATACGAGGGAAAACCCATTGCATGCCGAATTAAATAACAACTTTTACTGCCCACACAACAGCGAGCCCTTAAAGCGCAAGGTTATACAAGGGTAGCTCATCGTTCGAAATTAAGCTTTTGGCCTCCGTGTCGGTGTCGGCCAAGAGCTCTATGCAAGAAGACGTGACCGTTGACGAGGCCAAACCGCAAGCAGCAGCTCATACTGAAACCATTTTCGATTTAAAGCGCAGCTGCGCAGCTTGGAGCATCAAAGCCAT

Full Affymetrix probeset data:

Annotations for 1637071_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime