FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637072_at:

>probe:Drosophila_2:1637072_at:660:337; Interrogation_Position=1002; Antisense; GCTCGGAACGCCAACAACATGTGTG
>probe:Drosophila_2:1637072_at:527:269; Interrogation_Position=1019; Antisense; CATGTGTGGAGTGGCATCACTTCCC
>probe:Drosophila_2:1637072_at:312:265; Interrogation_Position=1087; Antisense; CAGTAGGATCATATCTCCCAGTTGA
>probe:Drosophila_2:1637072_at:457:137; Interrogation_Position=1117; Antisense; ACGTATTTTATATCGCTTTTGCATT
>probe:Drosophila_2:1637072_at:371:143; Interrogation_Position=568; Antisense; ACTGTGTTCCCTATCCGAATAACGG
>probe:Drosophila_2:1637072_at:479:609; Interrogation_Position=610; Antisense; TGAGCGTGGCCTTTAACTACACCAG
>probe:Drosophila_2:1637072_at:684:225; Interrogation_Position=654; Antisense; AAGGAATCCTATCCGTACGAGCCTG
>probe:Drosophila_2:1637072_at:284:221; Interrogation_Position=710; Antisense; AAGTGCAGGCACATTGTCGGGCTAC
>probe:Drosophila_2:1637072_at:274:495; Interrogation_Position=735; Antisense; GTCACTCTCGGCAACTACGATGAAC
>probe:Drosophila_2:1637072_at:695:363; Interrogation_Position=825; Antisense; GAATTCGATCAGTACTCCGGTGGAG
>probe:Drosophila_2:1637072_at:471:531; Interrogation_Position=843; Antisense; GGTGGAGTCCTCAGTATTCCGGCGT
>probe:Drosophila_2:1637072_at:637:719; Interrogation_Position=859; Antisense; TTCCGGCGTGCAGATCTAAGAGACA
>probe:Drosophila_2:1637072_at:395:213; Interrogation_Position=876; Antisense; AAGAGACAGGACCTTACACACTCCG
>probe:Drosophila_2:1637072_at:325:155; Interrogation_Position=891; Antisense; ACACACTCCGTTCTTTTAGTCGGCT

Paste this into a BLAST search page for me
GCTCGGAACGCCAACAACATGTGTGCATGTGTGGAGTGGCATCACTTCCCCAGTAGGATCATATCTCCCAGTTGAACGTATTTTATATCGCTTTTGCATTACTGTGTTCCCTATCCGAATAACGGTGAGCGTGGCCTTTAACTACACCAGAAGGAATCCTATCCGTACGAGCCTGAAGTGCAGGCACATTGTCGGGCTACGTCACTCTCGGCAACTACGATGAACGAATTCGATCAGTACTCCGGTGGAGGGTGGAGTCCTCAGTATTCCGGCGTTTCCGGCGTGCAGATCTAAGAGACAAAGAGACAGGACCTTACACACTCCGACACACTCCGTTCTTTTAGTCGGCT

Full Affymetrix probeset data:

Annotations for 1637072_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720