Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637073_a_at:

>probe:Drosophila_2:1637073_a_at:664:59; Interrogation_Position=142; Antisense; ATGTTCACCTATCGCCTGAAACTGA
>probe:Drosophila_2:1637073_a_at:268:613; Interrogation_Position=158; Antisense; TGAAACTGATGATCCTTCTGGGTCA
>probe:Drosophila_2:1637073_a_at:639:335; Interrogation_Position=183; Antisense; GCTGCTGCTAGGCATCCAATGTTAT
>probe:Drosophila_2:1637073_a_at:53:445; Interrogation_Position=217; Antisense; GATGATGTGTCCTCCAATGCAGTGG
>probe:Drosophila_2:1637073_a_at:139:269; Interrogation_Position=244; Antisense; CATTCGGCGGGACTTTTGGGCCACT
>probe:Drosophila_2:1637073_a_at:22:611; Interrogation_Position=281; Antisense; TGACTGGCGGCGAGGCCTTGTCCAA
>probe:Drosophila_2:1637073_a_at:375:729; Interrogation_Position=298; Antisense; TTGTCCAAGCTGGACTTCAGCTCAT
>probe:Drosophila_2:1637073_a_at:449:117; Interrogation_Position=316; Antisense; AGCTCATCTTCGCACGAATTCGGAG
>probe:Drosophila_2:1637073_a_at:57:327; Interrogation_Position=386; Antisense; GCGAGGAGAGCTTCCCGTCAGATTA
>probe:Drosophila_2:1637073_a_at:442:75; Interrogation_Position=470; Antisense; AGGACCACAAGGCTGTGCCCGGCAT
>probe:Drosophila_2:1637073_a_at:5:43; Interrogation_Position=493; Antisense; ATCGATCATGGCAAGGGCGCCTTCA
>probe:Drosophila_2:1637073_a_at:307:667; Interrogation_Position=520; Antisense; TACAGCACCCTGTACGAGTTCAAGG
>probe:Drosophila_2:1637073_a_at:478:529; Interrogation_Position=548; Antisense; GGGATGAGCACGAACTGCACCACAT
>probe:Drosophila_2:1637073_a_at:80:113; Interrogation_Position=575; Antisense; AGCACCAGGCACTCGAACAGCAGGT

Paste this into a BLAST search page for me
ATGTTCACCTATCGCCTGAAACTGATGAAACTGATGATCCTTCTGGGTCAGCTGCTGCTAGGCATCCAATGTTATGATGATGTGTCCTCCAATGCAGTGGCATTCGGCGGGACTTTTGGGCCACTTGACTGGCGGCGAGGCCTTGTCCAATTGTCCAAGCTGGACTTCAGCTCATAGCTCATCTTCGCACGAATTCGGAGGCGAGGAGAGCTTCCCGTCAGATTAAGGACCACAAGGCTGTGCCCGGCATATCGATCATGGCAAGGGCGCCTTCATACAGCACCCTGTACGAGTTCAAGGGGGATGAGCACGAACTGCACCACATAGCACCAGGCACTCGAACAGCAGGT

Full Affymetrix probeset data:

Annotations for 1637073_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime