FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637074_at:

>probe:Drosophila_2:1637074_at:382:3; Interrogation_Position=284; Antisense; ATTCTGGGAAATTACCGGCTGCGTC
>probe:Drosophila_2:1637074_at:444:393; Interrogation_Position=329; Antisense; GTACATACGGCAGGCGCCCAATATG
>probe:Drosophila_2:1637074_at:707:309; Interrogation_Position=346; Antisense; CCAATATGCCCAAGATGTCCACGAT
>probe:Drosophila_2:1637074_at:121:597; Interrogation_Position=361; Antisense; TGTCCACGATGTAGCGGAACCCGTA
>probe:Drosophila_2:1637074_at:55:215; Interrogation_Position=407; Antisense; AAGTTTTACAAGTCGCGATTTCAGA
>probe:Drosophila_2:1637074_at:519:291; Interrogation_Position=437; Antisense; CGTGTATCTGATTCTGCGGGCCGTA
>probe:Drosophila_2:1637074_at:724:17; Interrogation_Position=511; Antisense; ATTTGACCGGAGACAAGCCGCCCAG
>probe:Drosophila_2:1637074_at:644:321; Interrogation_Position=530; Antisense; GCCCAGGCCAAATACGATCGAATAA
>probe:Drosophila_2:1637074_at:418:69; Interrogation_Position=583; Antisense; AGGCCAGACTGACATGGTCCTGCTG
>probe:Drosophila_2:1637074_at:647:621; Interrogation_Position=603; Antisense; TGCTGGCCTTTATCTTTGCCGGAGT
>probe:Drosophila_2:1637074_at:216:287; Interrogation_Position=622; Antisense; CGGAGTGGCCGTATACCTGATGTTC
>probe:Drosophila_2:1637074_at:52:687; Interrogation_Position=633; Antisense; TATACCTGATGTTCCTCGCCGAAAG
>probe:Drosophila_2:1637074_at:41:673; Interrogation_Position=662; Antisense; TACGACACTCCCAAGCAGAAAGCGA
>probe:Drosophila_2:1637074_at:330:363; Interrogation_Position=748; Antisense; GAATTCTCTAGTCTTCAGCGTACAT

Paste this into a BLAST search page for me
ATTCTGGGAAATTACCGGCTGCGTCGTACATACGGCAGGCGCCCAATATGCCAATATGCCCAAGATGTCCACGATTGTCCACGATGTAGCGGAACCCGTAAAGTTTTACAAGTCGCGATTTCAGACGTGTATCTGATTCTGCGGGCCGTAATTTGACCGGAGACAAGCCGCCCAGGCCCAGGCCAAATACGATCGAATAAAGGCCAGACTGACATGGTCCTGCTGTGCTGGCCTTTATCTTTGCCGGAGTCGGAGTGGCCGTATACCTGATGTTCTATACCTGATGTTCCTCGCCGAAAGTACGACACTCCCAAGCAGAAAGCGAGAATTCTCTAGTCTTCAGCGTACAT

Full Affymetrix probeset data:

Annotations for 1637074_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720