FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637075_at:

>probe:Drosophila_2:1637075_at:73:367; Interrogation_Position=132; Antisense; GAATCAGGAGGAGAAGTCGCACTTG
>probe:Drosophila_2:1637075_at:723:501; Interrogation_Position=147; Antisense; GTCGCACTTGGAACAGAGAAAGCTA
>probe:Drosophila_2:1637075_at:354:547; Interrogation_Position=189; Antisense; GGAGGAATTAAATCGCAAAGCCACT
>probe:Drosophila_2:1637075_at:359:259; Interrogation_Position=210; Antisense; CACTTTAAAACTGGCTCAGCTCGAG
>probe:Drosophila_2:1637075_at:678:279; Interrogation_Position=224; Antisense; CTCAGCTCGAGGAGGAGGGATCCCT
>probe:Drosophila_2:1637075_at:383:529; Interrogation_Position=240; Antisense; GGGATCCCTGTCCACACAGGAGATA
>probe:Drosophila_2:1637075_at:211:209; Interrogation_Position=25; Antisense; AAGCTAGAGAGCCAATTCCCCGAGG
>probe:Drosophila_2:1637075_at:113:677; Interrogation_Position=263; Antisense; TAGCACCCACAGCACCCGAAGAGGA
>probe:Drosophila_2:1637075_at:529:641; Interrogation_Position=291; Antisense; TCTCGATTCCAGCATTTTCCTTATG
>probe:Drosophila_2:1637075_at:520:695; Interrogation_Position=306; Antisense; TTTCCTTATGCCAGATTTTCCCGGA
>probe:Drosophila_2:1637075_at:199:713; Interrogation_Position=333; Antisense; TTCAGCTCCGCCAGAAAGCATACTC
>probe:Drosophila_2:1637075_at:394:393; Interrogation_Position=346; Antisense; GAAAGCATACTCTCCATCGAGCCGG
>probe:Drosophila_2:1637075_at:269:271; Interrogation_Position=360; Antisense; CATCGAGCCGGATTTCTGCTATTAG
>probe:Drosophila_2:1637075_at:184:357; Interrogation_Position=68; Antisense; GCAAATTCGATCCAGAGTCAGCCAA

Paste this into a BLAST search page for me
GAATCAGGAGGAGAAGTCGCACTTGGTCGCACTTGGAACAGAGAAAGCTAGGAGGAATTAAATCGCAAAGCCACTCACTTTAAAACTGGCTCAGCTCGAGCTCAGCTCGAGGAGGAGGGATCCCTGGGATCCCTGTCCACACAGGAGATAAAGCTAGAGAGCCAATTCCCCGAGGTAGCACCCACAGCACCCGAAGAGGATCTCGATTCCAGCATTTTCCTTATGTTTCCTTATGCCAGATTTTCCCGGATTCAGCTCCGCCAGAAAGCATACTCGAAAGCATACTCTCCATCGAGCCGGCATCGAGCCGGATTTCTGCTATTAGGCAAATTCGATCCAGAGTCAGCCAA

Full Affymetrix probeset data:

Annotations for 1637075_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720