FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637076_at:

>probe:Drosophila_2:1637076_at:285:255; Interrogation_Position=1044; Antisense; CAAAATTCTGTGAACGGGACCTAAT
>probe:Drosophila_2:1637076_at:496:21; Interrogation_Position=1152; Antisense; ATATTTTGGCCAACATGTTTGCTGT
>probe:Drosophila_2:1637076_at:392:479; Interrogation_Position=1168; Antisense; GTTTGCTGTTATTACTTTGAGGCTT
>probe:Drosophila_2:1637076_at:517:607; Interrogation_Position=1185; Antisense; TGAGGCTTTGTATTTCTGTCTGTCT
>probe:Drosophila_2:1637076_at:2:483; Interrogation_Position=1194; Antisense; GTATTTCTGTCTGTCTTCCCAAAAA
>probe:Drosophila_2:1637076_at:105:691; Interrogation_Position=780; Antisense; TATTGCTGCACCGAGGACGGATGCA
>probe:Drosophila_2:1637076_at:653:545; Interrogation_Position=798; Antisense; GGATGCAACTCTGGCACCCAATTGG
>probe:Drosophila_2:1637076_at:364:247; Interrogation_Position=817; Antisense; AATTGGCCTACTCCGTCATCCTGTT
>probe:Drosophila_2:1637076_at:216:235; Interrogation_Position=851; Antisense; AATCCTTTCGGTGGCTTGGCCAACA
>probe:Drosophila_2:1637076_at:282:521; Interrogation_Position=861; Antisense; GTGGCTTGGCCAACATTCGTTGATT
>probe:Drosophila_2:1637076_at:714:465; Interrogation_Position=879; Antisense; GTTGATTTTTGGAATACGCGACGTT
>probe:Drosophila_2:1637076_at:97:27; Interrogation_Position=892; Antisense; ATACGCGACGTTAAGTGGGTCCTCA
>probe:Drosophila_2:1637076_at:157:593; Interrogation_Position=907; Antisense; TGGGTCCTCAGGTGATCCAGCCAAT
>probe:Drosophila_2:1637076_at:61:239; Interrogation_Position=929; Antisense; AATCTTCGCTCGGTTCTTAACTTGA

Paste this into a BLAST search page for me
CAAAATTCTGTGAACGGGACCTAATATATTTTGGCCAACATGTTTGCTGTGTTTGCTGTTATTACTTTGAGGCTTTGAGGCTTTGTATTTCTGTCTGTCTGTATTTCTGTCTGTCTTCCCAAAAATATTGCTGCACCGAGGACGGATGCAGGATGCAACTCTGGCACCCAATTGGAATTGGCCTACTCCGTCATCCTGTTAATCCTTTCGGTGGCTTGGCCAACAGTGGCTTGGCCAACATTCGTTGATTGTTGATTTTTGGAATACGCGACGTTATACGCGACGTTAAGTGGGTCCTCATGGGTCCTCAGGTGATCCAGCCAATAATCTTCGCTCGGTTCTTAACTTGA

Full Affymetrix probeset data:

Annotations for 1637076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720