Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637080_at:

>probe:Drosophila_2:1637080_at:46:83; Interrogation_Position=1022; Antisense; AGGGATGCGCCTAGCAACTGATAAT
>probe:Drosophila_2:1637080_at:435:639; Interrogation_Position=507; Antisense; TCGGGCTGACCGAGCTGCCGATGAA
>probe:Drosophila_2:1637080_at:446:425; Interrogation_Position=584; Antisense; GAGAGTAACGTCGAGTCCCATTTGT
>probe:Drosophila_2:1637080_at:208:21; Interrogation_Position=603; Antisense; ATTTGTCGCGAATGCCCAAGCTGAG
>probe:Drosophila_2:1637080_at:493:69; Interrogation_Position=642; Antisense; AGGCCAATGACTGTGTGTGCTACGA
>probe:Drosophila_2:1637080_at:426:121; Interrogation_Position=678; Antisense; AGCGGCGCGAACAGTGGTGTCCCAC
>probe:Drosophila_2:1637080_at:37:299; Interrogation_Position=729; Antisense; CGCTCTTCAACCTCTGCAAAATGCA
>probe:Drosophila_2:1637080_at:615:685; Interrogation_Position=763; Antisense; TATAGTGCTGATCCTGAGACTGGTG
>probe:Drosophila_2:1637080_at:380:105; Interrogation_Position=779; Antisense; AGACTGGTGTGCAATGGGCCCTCTG
>probe:Drosophila_2:1637080_at:484:251; Interrogation_Position=838; Antisense; CAAGGATCCCTGCAACTGTTGCTGT
>probe:Drosophila_2:1637080_at:671:715; Interrogation_Position=902; Antisense; TTCGATCCCTGCGATCCTTGCAAGA
>probe:Drosophila_2:1637080_at:720:723; Interrogation_Position=919; Antisense; TTGCAAGACCGTGCCAGCCAAGAAG
>probe:Drosophila_2:1637080_at:497:119; Interrogation_Position=961; Antisense; AGCTGCGAGCCTTTATATTCCGTAC
>probe:Drosophila_2:1637080_at:554:687; Interrogation_Position=976; Antisense; TATTCCGTACTCATTTAGTTGCCAT

Paste this into a BLAST search page for me
AGGGATGCGCCTAGCAACTGATAATTCGGGCTGACCGAGCTGCCGATGAAGAGAGTAACGTCGAGTCCCATTTGTATTTGTCGCGAATGCCCAAGCTGAGAGGCCAATGACTGTGTGTGCTACGAAGCGGCGCGAACAGTGGTGTCCCACCGCTCTTCAACCTCTGCAAAATGCATATAGTGCTGATCCTGAGACTGGTGAGACTGGTGTGCAATGGGCCCTCTGCAAGGATCCCTGCAACTGTTGCTGTTTCGATCCCTGCGATCCTTGCAAGATTGCAAGACCGTGCCAGCCAAGAAGAGCTGCGAGCCTTTATATTCCGTACTATTCCGTACTCATTTAGTTGCCAT

Full Affymetrix probeset data:

Annotations for 1637080_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime