FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637084_at:

>probe:Drosophila_2:1637084_at:91:47; Interrogation_Position=1222; Antisense; ATCCAGTACCTTACAGACTCGTTGC
>probe:Drosophila_2:1637084_at:394:667; Interrogation_Position=1233; Antisense; TACAGACTCGTTGCGGTCAGAGCCG
>probe:Drosophila_2:1637084_at:422:101; Interrogation_Position=1251; Antisense; AGAGCCGCACCTACTTATGAAAGCC
>probe:Drosophila_2:1637084_at:54:393; Interrogation_Position=1269; Antisense; GAAAGCCTAAGAGTCCTTCAGGATT
>probe:Drosophila_2:1637084_at:36:297; Interrogation_Position=1308; Antisense; CGACTTAGATCGACGCACACACATA
>probe:Drosophila_2:1637084_at:725:255; Interrogation_Position=1333; Antisense; CACAAACTGTTTGCATTTAGCTGGC
>probe:Drosophila_2:1637084_at:107:121; Interrogation_Position=1351; Antisense; AGCTGGCAGAGCTTAGCCCTTAAGA
>probe:Drosophila_2:1637084_at:703:649; Interrogation_Position=1418; Antisense; TATTATCCCAAGCTTACCGGTACCA
>probe:Drosophila_2:1637084_at:514:597; Interrogation_Position=1474; Antisense; TGTGCTTTACTTTTGTTTACCTGAA
>probe:Drosophila_2:1637084_at:177:479; Interrogation_Position=1559; Antisense; GTTTAACGACTCCTGTATTTGATAC
>probe:Drosophila_2:1637084_at:335:489; Interrogation_Position=1629; Antisense; GTACTCAACACAATCATATGCCTTA
>probe:Drosophila_2:1637084_at:726:263; Interrogation_Position=1685; Antisense; CATACAACAAGCTTTCCTCAATTCC
>probe:Drosophila_2:1637084_at:146:299; Interrogation_Position=1709; Antisense; CCCTTGTTACCCGAATGTATTCCAT
>probe:Drosophila_2:1637084_at:572:481; Interrogation_Position=1725; Antisense; GTATTCCATCAAATCCCTACAAAAT

Paste this into a BLAST search page for me
ATCCAGTACCTTACAGACTCGTTGCTACAGACTCGTTGCGGTCAGAGCCGAGAGCCGCACCTACTTATGAAAGCCGAAAGCCTAAGAGTCCTTCAGGATTCGACTTAGATCGACGCACACACATACACAAACTGTTTGCATTTAGCTGGCAGCTGGCAGAGCTTAGCCCTTAAGATATTATCCCAAGCTTACCGGTACCATGTGCTTTACTTTTGTTTACCTGAAGTTTAACGACTCCTGTATTTGATACGTACTCAACACAATCATATGCCTTACATACAACAAGCTTTCCTCAATTCCCCCTTGTTACCCGAATGTATTCCATGTATTCCATCAAATCCCTACAAAAT

Full Affymetrix probeset data:

Annotations for 1637084_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720