Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637085_at:

>probe:Drosophila_2:1637085_at:599:369; Interrogation_Position=1014; Antisense; GAAGGTTCTTTCCAAGCCACTGTTT
>probe:Drosophila_2:1637085_at:688:203; Interrogation_Position=1027; Antisense; AAGCCACTGTTTTCACGACCTTTGA
>probe:Drosophila_2:1637085_at:6:297; Interrogation_Position=1042; Antisense; CGACCTTTGATTAGACTTAAGCCAA
>probe:Drosophila_2:1637085_at:388:185; Interrogation_Position=1065; Antisense; AAAATGCGAGACTTTGTCCAGCAAA
>probe:Drosophila_2:1637085_at:15:485; Interrogation_Position=1108; Antisense; GTATGTCCTTGCAGTAGAGTTCGAT
>probe:Drosophila_2:1637085_at:398:539; Interrogation_Position=1191; Antisense; GGTTTGATTTATGACAATCCCTACC
>probe:Drosophila_2:1637085_at:713:161; Interrogation_Position=1204; Antisense; ACAATCCCTACCAATGTGACACTTA
>probe:Drosophila_2:1637085_at:363:655; Interrogation_Position=1227; Antisense; TAATATAGCCATTTGAGCTGCCAAA
>probe:Drosophila_2:1637085_at:430:247; Interrogation_Position=1341; Antisense; AATTGTTCAAATTCCTAGACGATAT
>probe:Drosophila_2:1637085_at:401:409; Interrogation_Position=1358; Antisense; GACGATATCTACTGTTTGTGTGAAT
>probe:Drosophila_2:1637085_at:505:391; Interrogation_Position=1398; Antisense; GAAATCCTAGTTTCTGTTTTCAAAG
>probe:Drosophila_2:1637085_at:672:147; Interrogation_Position=1430; Antisense; ACTAGGCAATACATCTGGTTTCCAA
>probe:Drosophila_2:1637085_at:261:433; Interrogation_Position=1462; Antisense; GAGTGTCGACGATTTTCTTATTACA
>probe:Drosophila_2:1637085_at:378:247; Interrogation_Position=1586; Antisense; CAATAAAGACACTTACCGCAGCACT

Paste this into a BLAST search page for me
GAAGGTTCTTTCCAAGCCACTGTTTAAGCCACTGTTTTCACGACCTTTGACGACCTTTGATTAGACTTAAGCCAAAAAATGCGAGACTTTGTCCAGCAAAGTATGTCCTTGCAGTAGAGTTCGATGGTTTGATTTATGACAATCCCTACCACAATCCCTACCAATGTGACACTTATAATATAGCCATTTGAGCTGCCAAAAATTGTTCAAATTCCTAGACGATATGACGATATCTACTGTTTGTGTGAATGAAATCCTAGTTTCTGTTTTCAAAGACTAGGCAATACATCTGGTTTCCAAGAGTGTCGACGATTTTCTTATTACACAATAAAGACACTTACCGCAGCACT

Full Affymetrix probeset data:

Annotations for 1637085_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime