FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637086_at:

>probe:Drosophila_2:1637086_at:622:193; Interrogation_Position=425; Antisense; AACTCGACTTCGATTCCTTGGATGA
>probe:Drosophila_2:1637086_at:682:51; Interrogation_Position=452; Antisense; ATGCGGCGCCCAGAGACTATATGGT
>probe:Drosophila_2:1637086_at:121:375; Interrogation_Position=505; Antisense; GAAGATCCGCAGTTCTACCATGATA
>probe:Drosophila_2:1637086_at:615:439; Interrogation_Position=550; Antisense; GAGGCCGTGGTCTTTGACCTATATA
>probe:Drosophila_2:1637086_at:327:129; Interrogation_Position=566; Antisense; ACCTATATAAGCATCCAGCCTGTCT
>probe:Drosophila_2:1637086_at:569:405; Interrogation_Position=616; Antisense; GACTCCTTCATAGCCGTTGGGTGGG
>probe:Drosophila_2:1637086_at:288:107; Interrogation_Position=719; Antisense; AGAAACTGCTTACCCGGCAGGTGGA
>probe:Drosophila_2:1637086_at:374:129; Interrogation_Position=773; Antisense; ACCAGCTCTGTGTTGGTTCGGAGAT
>probe:Drosophila_2:1637086_at:726:489; Interrogation_Position=812; Antisense; GTAACGGCGACTCAGGAGGACCTTT
>probe:Drosophila_2:1637086_at:75:437; Interrogation_Position=827; Antisense; GAGGACCTTTGCTAATGTACCATCG
>probe:Drosophila_2:1637086_at:372:637; Interrogation_Position=849; Antisense; TCGGGAATATCCCTGTATGTACGTA
>probe:Drosophila_2:1637086_at:184:73; Interrogation_Position=915; Antisense; AGGAATACCCGGAATCTACACTCGC
>probe:Drosophila_2:1637086_at:23:667; Interrogation_Position=931; Antisense; TACACTCGCGTCTATCCTTATTTAG
>probe:Drosophila_2:1637086_at:319:455; Interrogation_Position=960; Antisense; GATAGCCCGAACTTTGGCCACGTTT

Paste this into a BLAST search page for me
AACTCGACTTCGATTCCTTGGATGAATGCGGCGCCCAGAGACTATATGGTGAAGATCCGCAGTTCTACCATGATAGAGGCCGTGGTCTTTGACCTATATAACCTATATAAGCATCCAGCCTGTCTGACTCCTTCATAGCCGTTGGGTGGGAGAAACTGCTTACCCGGCAGGTGGAACCAGCTCTGTGTTGGTTCGGAGATGTAACGGCGACTCAGGAGGACCTTTGAGGACCTTTGCTAATGTACCATCGTCGGGAATATCCCTGTATGTACGTAAGGAATACCCGGAATCTACACTCGCTACACTCGCGTCTATCCTTATTTAGGATAGCCCGAACTTTGGCCACGTTT

Full Affymetrix probeset data:

Annotations for 1637086_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720