FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637089_at:

>probe:Drosophila_2:1637089_at:638:41; Interrogation_Position=454; Antisense; ATCGTTCTGGTGTCCGTTTGGCCGT
>probe:Drosophila_2:1637089_at:618:627; Interrogation_Position=466; Antisense; TCCGTTTGGCCGTCTAGTAGTGACA
>probe:Drosophila_2:1637089_at:673:73; Interrogation_Position=504; Antisense; AGGAAACAAGGCCATCACCCAAGCA
>probe:Drosophila_2:1637089_at:402:295; Interrogation_Position=533; Antisense; CGCACTAAAGGCCTCCTAGGGAGTG
>probe:Drosophila_2:1637089_at:371:279; Interrogation_Position=545; Antisense; CTCCTAGGGAGTGAGGTAAACACAT
>probe:Drosophila_2:1637089_at:466:507; Interrogation_Position=587; Antisense; GGACCAAACAAACACAACTGGGACG
>probe:Drosophila_2:1637089_at:495:391; Interrogation_Position=612; Antisense; GAAACCTTTCTGGTCTTTTCGCGCA
>probe:Drosophila_2:1637089_at:437:697; Interrogation_Position=618; Antisense; TTTCTGGTCTTTTCGCGCAATGAGA
>probe:Drosophila_2:1637089_at:21:499; Interrogation_Position=624; Antisense; GTCTTTTCGCGCAATGAGAGAAGGG
>probe:Drosophila_2:1637089_at:128:545; Interrogation_Position=668; Antisense; GGATAACTTACTAAAATTGCGTCTA
>probe:Drosophila_2:1637089_at:337:661; Interrogation_Position=739; Antisense; TAACATTTTTACGTGTCGTAGCCGA
>probe:Drosophila_2:1637089_at:230:697; Interrogation_Position=746; Antisense; TTTACGTGTCGTAGCCGAGACCAGA
>probe:Drosophila_2:1637089_at:175:487; Interrogation_Position=756; Antisense; GTAGCCGAGACCAGAGGTCCCATTA
>probe:Drosophila_2:1637089_at:260:435; Interrogation_Position=769; Antisense; GAGGTCCCATTAATGTGTATTGCAT

Paste this into a BLAST search page for me
ATCGTTCTGGTGTCCGTTTGGCCGTTCCGTTTGGCCGTCTAGTAGTGACAAGGAAACAAGGCCATCACCCAAGCACGCACTAAAGGCCTCCTAGGGAGTGCTCCTAGGGAGTGAGGTAAACACATGGACCAAACAAACACAACTGGGACGGAAACCTTTCTGGTCTTTTCGCGCATTTCTGGTCTTTTCGCGCAATGAGAGTCTTTTCGCGCAATGAGAGAAGGGGGATAACTTACTAAAATTGCGTCTATAACATTTTTACGTGTCGTAGCCGATTTACGTGTCGTAGCCGAGACCAGAGTAGCCGAGACCAGAGGTCCCATTAGAGGTCCCATTAATGTGTATTGCAT

Full Affymetrix probeset data:

Annotations for 1637089_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720