FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637093_at:

>probe:Drosophila_2:1637093_at:328:61; Interrogation_Position=1015; Antisense; ATGTCCCTAGTCGTAACTCGAGCAA
>probe:Drosophila_2:1637093_at:694:421; Interrogation_Position=1034; Antisense; GAGCAAGGTGATGTCCTTCCGACGC
>probe:Drosophila_2:1637093_at:190:325; Interrogation_Position=1057; Antisense; GCGACTGCCAGGACAAGCCGTTGAT
>probe:Drosophila_2:1637093_at:139:199; Interrogation_Position=1106; Antisense; AACGTTTCGCACTTATTTCACATCC
>probe:Drosophila_2:1637093_at:535:153; Interrogation_Position=1136; Antisense; ACAGGACCGCTGCAATGGACACGAT
>probe:Drosophila_2:1637093_at:579:665; Interrogation_Position=1204; Antisense; TACACAACGCTATTATTCCTGGAAA
>probe:Drosophila_2:1637093_at:79:219; Interrogation_Position=1229; Antisense; AAGTCCTGGTCAAATCGCATTCCTT
>probe:Drosophila_2:1637093_at:366:705; Interrogation_Position=1252; Antisense; TTAGCCCCTGGATACATATTGTTTT
>probe:Drosophila_2:1637093_at:395:643; Interrogation_Position=710; Antisense; TCTCCCCTTTTGTGTGAATATGCGT
>probe:Drosophila_2:1637093_at:675:85; Interrogation_Position=745; Antisense; AGTGCAGACTCCTTGATTATTTTCA
>probe:Drosophila_2:1637093_at:545:701; Interrogation_Position=764; Antisense; TTTTCACAGTATTGACGCAGCTCGT
>probe:Drosophila_2:1637093_at:465:261; Interrogation_Position=781; Antisense; CAGCTCGTCTGGCTTTAATTTCCAA
>probe:Drosophila_2:1637093_at:443:503; Interrogation_Position=813; Antisense; GTCCGCCAGGTCTTACATAACCAAA
>probe:Drosophila_2:1637093_at:375:675; Interrogation_Position=857; Antisense; TAGCGACTCATTAGACAGGCCGAAT

Paste this into a BLAST search page for me
ATGTCCCTAGTCGTAACTCGAGCAAGAGCAAGGTGATGTCCTTCCGACGCGCGACTGCCAGGACAAGCCGTTGATAACGTTTCGCACTTATTTCACATCCACAGGACCGCTGCAATGGACACGATTACACAACGCTATTATTCCTGGAAAAAGTCCTGGTCAAATCGCATTCCTTTTAGCCCCTGGATACATATTGTTTTTCTCCCCTTTTGTGTGAATATGCGTAGTGCAGACTCCTTGATTATTTTCATTTTCACAGTATTGACGCAGCTCGTCAGCTCGTCTGGCTTTAATTTCCAAGTCCGCCAGGTCTTACATAACCAAATAGCGACTCATTAGACAGGCCGAAT

Full Affymetrix probeset data:

Annotations for 1637093_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720