FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637094_at:

>probe:Drosophila_2:1637094_at:108:365; Interrogation_Position=1088; Antisense; GAATCATCTGATCCCTCGATAAAGC
>probe:Drosophila_2:1637094_at:440:219; Interrogation_Position=1130; Antisense; AAGTCGCTGTGCTAATTGGATATCA
>probe:Drosophila_2:1637094_at:505:679; Interrogation_Position=1181; Antisense; TAGGCACACCTCACAGCTATTACAA
>probe:Drosophila_2:1637094_at:263:223; Interrogation_Position=647; Antisense; AAGGTATCCGACATATTCGTCTCGC
>probe:Drosophila_2:1637094_at:214:687; Interrogation_Position=660; Antisense; TATTCGTCTCGCCAAAGGACTGCAC
>probe:Drosophila_2:1637094_at:135:225; Interrogation_Position=674; Antisense; AAGGACTGCACCGATCGCTGTGATG
>probe:Drosophila_2:1637094_at:171:51; Interrogation_Position=696; Antisense; ATGCGCTGATGCTGGCTCAAGTGGA
>probe:Drosophila_2:1637094_at:129:399; Interrogation_Position=752; Antisense; GACATCGAGAACATGCGGCAGCGTA
>probe:Drosophila_2:1637094_at:241:287; Interrogation_Position=798; Antisense; CGGCTCTAACTGTGCTGGGTCTAAA
>probe:Drosophila_2:1637094_at:199:383; Interrogation_Position=842; Antisense; GAACGATCCTACAACGAGTCCAGAG
>probe:Drosophila_2:1637094_at:223:433; Interrogation_Position=857; Antisense; GAGTCCAGAGTGCAGTGCCTCAGAT
>probe:Drosophila_2:1637094_at:263:25; Interrogation_Position=947; Antisense; ATAGATGCGATTACCAACCTTCACC
>probe:Drosophila_2:1637094_at:155:711; Interrogation_Position=966; Antisense; TTCACCGAATCCTTCTACGGCGAAG
>probe:Drosophila_2:1637094_at:627:213; Interrogation_Position=988; Antisense; AAGAGATGTACATTCGTTTCCCGCT

Paste this into a BLAST search page for me
GAATCATCTGATCCCTCGATAAAGCAAGTCGCTGTGCTAATTGGATATCATAGGCACACCTCACAGCTATTACAAAAGGTATCCGACATATTCGTCTCGCTATTCGTCTCGCCAAAGGACTGCACAAGGACTGCACCGATCGCTGTGATGATGCGCTGATGCTGGCTCAAGTGGAGACATCGAGAACATGCGGCAGCGTACGGCTCTAACTGTGCTGGGTCTAAAGAACGATCCTACAACGAGTCCAGAGGAGTCCAGAGTGCAGTGCCTCAGATATAGATGCGATTACCAACCTTCACCTTCACCGAATCCTTCTACGGCGAAGAAGAGATGTACATTCGTTTCCCGCT

Full Affymetrix probeset data:

Annotations for 1637094_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720