FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637095_at:

>probe:Drosophila_2:1637095_at:395:251; Interrogation_Position=1048; Antisense; CAAGTGATTGCCACAGATAGGAAAT
>probe:Drosophila_2:1637095_at:486:183; Interrogation_Position=1094; Antisense; AAAAGTCGACATGGCGCCGTAAATA
>probe:Drosophila_2:1637095_at:611:707; Interrogation_Position=1193; Antisense; TTCCCCGCACGTCGTAAATTAAGAT
>probe:Drosophila_2:1637095_at:620:207; Interrogation_Position=1213; Antisense; AAGATTGATTCCTCGTTAAGATTAT
>probe:Drosophila_2:1637095_at:416:163; Interrogation_Position=1239; Antisense; AAATTTATCGTACTCGACAAGCACT
>probe:Drosophila_2:1637095_at:75:81; Interrogation_Position=698; Antisense; AGGGCGAGTTTATATCCTTGGCCTC
>probe:Drosophila_2:1637095_at:259:577; Interrogation_Position=716; Antisense; TGGCCTCCGGCAAACGAGCTACCTA
>probe:Drosophila_2:1637095_at:30:419; Interrogation_Position=731; Antisense; GAGCTACCTACTTCAAGTGGCGCAA
>probe:Drosophila_2:1637095_at:623:239; Interrogation_Position=767; Antisense; AATACAATAATCCTACCCAGCACTG
>probe:Drosophila_2:1637095_at:322:625; Interrogation_Position=790; Antisense; TGCGCCTACGTTTTTGGGCACGAAA
>probe:Drosophila_2:1637095_at:395:15; Interrogation_Position=817; Antisense; ATTATGATCGTTCTGTCCTGTACCA
>probe:Drosophila_2:1637095_at:552:629; Interrogation_Position=832; Antisense; TCCTGTACCACTGACGTTATGCATT
>probe:Drosophila_2:1637095_at:242:693; Interrogation_Position=848; Antisense; TTATGCATTTCATTTGCCAATCAGA
>probe:Drosophila_2:1637095_at:424:245; Interrogation_Position=942; Antisense; AATTCACTTTACTGCATTTGATGCA

Paste this into a BLAST search page for me
CAAGTGATTGCCACAGATAGGAAATAAAAGTCGACATGGCGCCGTAAATATTCCCCGCACGTCGTAAATTAAGATAAGATTGATTCCTCGTTAAGATTATAAATTTATCGTACTCGACAAGCACTAGGGCGAGTTTATATCCTTGGCCTCTGGCCTCCGGCAAACGAGCTACCTAGAGCTACCTACTTCAAGTGGCGCAAAATACAATAATCCTACCCAGCACTGTGCGCCTACGTTTTTGGGCACGAAAATTATGATCGTTCTGTCCTGTACCATCCTGTACCACTGACGTTATGCATTTTATGCATTTCATTTGCCAATCAGAAATTCACTTTACTGCATTTGATGCA

Full Affymetrix probeset data:

Annotations for 1637095_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720