FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637097_at:

>probe:Drosophila_2:1637097_at:335:179; Interrogation_Position=1222; Antisense; AAACTAATGGCGTTCCTCAGCATCT
>probe:Drosophila_2:1637097_at:189:333; Interrogation_Position=1259; Antisense; GCTGGATGCCACAGATGATCGCCAT
>probe:Drosophila_2:1637097_at:416:41; Interrogation_Position=1304; Antisense; ATCGGGTGCCCGCATCGAACAAGTT
>probe:Drosophila_2:1637097_at:427:295; Interrogation_Position=1319; Antisense; CGAACAAGTTCTTCATCATCGCCGA
>probe:Drosophila_2:1637097_at:571:129; Interrogation_Position=1366; Antisense; ACCTCGGATCCGTATGTCTATGTGC
>probe:Drosophila_2:1637097_at:380:61; Interrogation_Position=1379; Antisense; ATGTCTATGTGCTGAGTCGCTCCAA
>probe:Drosophila_2:1637097_at:620:195; Interrogation_Position=1411; Antisense; AACTGGTCCTTGCTGGGATGCATTA
>probe:Drosophila_2:1637097_at:704:415; Interrogation_Position=1491; Antisense; GAGCCGCATGCGTACGACGATGACG
>probe:Drosophila_2:1637097_at:73:365; Interrogation_Position=1531; Antisense; GAATTCAACTGATTCCACTCGATCT
>probe:Drosophila_2:1637097_at:692:517; Interrogation_Position=1600; Antisense; GTGGGATCTCACTCAAAAAAGCGTT
>probe:Drosophila_2:1637097_at:700:419; Interrogation_Position=1638; Antisense; GAGCATTCCTGGGAGTAGCGCCTAG
>probe:Drosophila_2:1637097_at:269:323; Interrogation_Position=1655; Antisense; GCGCCTAGTCTCGTAAGCTGTAAAT
>probe:Drosophila_2:1637097_at:630:21; Interrogation_Position=1685; Antisense; ATATATCCCACTTCGTATCTTACTA
>probe:Drosophila_2:1637097_at:395:51; Interrogation_Position=1728; Antisense; ATGTATGTATTCTCACCTCACTTAA

Paste this into a BLAST search page for me
AAACTAATGGCGTTCCTCAGCATCTGCTGGATGCCACAGATGATCGCCATATCGGGTGCCCGCATCGAACAAGTTCGAACAAGTTCTTCATCATCGCCGAACCTCGGATCCGTATGTCTATGTGCATGTCTATGTGCTGAGTCGCTCCAAAACTGGTCCTTGCTGGGATGCATTAGAGCCGCATGCGTACGACGATGACGGAATTCAACTGATTCCACTCGATCTGTGGGATCTCACTCAAAAAAGCGTTGAGCATTCCTGGGAGTAGCGCCTAGGCGCCTAGTCTCGTAAGCTGTAAATATATATCCCACTTCGTATCTTACTAATGTATGTATTCTCACCTCACTTAA

Full Affymetrix probeset data:

Annotations for 1637097_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720