FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637098_at:

>probe:Drosophila_2:1637098_at:106:547; Interrogation_Position=171; Antisense; GGATGGACAACCGATTCCCAAACAG
>probe:Drosophila_2:1637098_at:10:189; Interrogation_Position=191; Antisense; AACAGGAGTATCCACAGCCGATGCC
>probe:Drosophila_2:1637098_at:298:479; Interrogation_Position=217; Antisense; GTTTCCAGACGCCTCATAAGATCGC
>probe:Drosophila_2:1637098_at:59:711; Interrogation_Position=247; Antisense; TTCACCACCGATATCCAACGAATGC
>probe:Drosophila_2:1637098_at:72:311; Interrogation_Position=270; Antisense; GCCAACGGAGGCCATTTACGCGGAA
>probe:Drosophila_2:1637098_at:7:17; Interrogation_Position=283; Antisense; ATTTACGCGGAATTCGATCGACTGA
>probe:Drosophila_2:1637098_at:383:285; Interrogation_Position=304; Antisense; CTGATTCAGCAGGTGGAGGGCCATC
>probe:Drosophila_2:1637098_at:6:89; Interrogation_Position=347; Antisense; AGTCACCGTGCTTGGATGTGGCCGC
>probe:Drosophila_2:1637098_at:84:501; Interrogation_Position=408; Antisense; GTCGTGCAACTGCTTTGCAGCTATG
>probe:Drosophila_2:1637098_at:8:593; Interrogation_Position=452; Antisense; TGGTGCGTGCCACACAGAATCGCGT
>probe:Drosophila_2:1637098_at:327:235; Interrogation_Position=469; Antisense; AATCGCGTGGACGACTTGGCGGACA
>probe:Drosophila_2:1637098_at:401:153; Interrogation_Position=491; Antisense; ACATGGAGCCGCCAATGATGCCGGT
>probe:Drosophila_2:1637098_at:140:565; Interrogation_Position=583; Antisense; TGGAAGTTTTGGACCTGGTTCCGCT
>probe:Drosophila_2:1637098_at:100:259; Interrogation_Position=83; Antisense; CACCGCAAAAGCAGGATTCGACGAC

Paste this into a BLAST search page for me
GGATGGACAACCGATTCCCAAACAGAACAGGAGTATCCACAGCCGATGCCGTTTCCAGACGCCTCATAAGATCGCTTCACCACCGATATCCAACGAATGCGCCAACGGAGGCCATTTACGCGGAAATTTACGCGGAATTCGATCGACTGACTGATTCAGCAGGTGGAGGGCCATCAGTCACCGTGCTTGGATGTGGCCGCGTCGTGCAACTGCTTTGCAGCTATGTGGTGCGTGCCACACAGAATCGCGTAATCGCGTGGACGACTTGGCGGACAACATGGAGCCGCCAATGATGCCGGTTGGAAGTTTTGGACCTGGTTCCGCTCACCGCAAAAGCAGGATTCGACGAC

Full Affymetrix probeset data:

Annotations for 1637098_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720