Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637100_at:

>probe:Drosophila_2:1637100_at:335:111; Interrogation_Position=1366; Antisense; AGCAAATCGCTTTGGGTCTGCCCGC
>probe:Drosophila_2:1637100_at:507:359; Interrogation_Position=1402; Antisense; GCAACGGTGAAACGCTCTTCGATCA
>probe:Drosophila_2:1637100_at:232:717; Interrogation_Position=1419; Antisense; TTCGATCAGCGTCTATTCAACACCA
>probe:Drosophila_2:1637100_at:109:127; Interrogation_Position=1443; Antisense; ACCAAGGGCATGGACTCCGGTTACG
>probe:Drosophila_2:1637100_at:352:63; Interrogation_Position=1486; Antisense; ATGTGTACGACAAGCCGTGGCGCGA
>probe:Drosophila_2:1637100_at:190:521; Interrogation_Position=1502; Antisense; GTGGCGCGATTCCAATACACTGGGC
>probe:Drosophila_2:1637100_at:296:191; Interrogation_Position=1566; Antisense; AACTACGGCGGTGATCTGGATGCCA
>probe:Drosophila_2:1637100_at:631:163; Interrogation_Position=1595; Antisense; AAATACCAAGCGTTTCGTGCCAGAC
>probe:Drosophila_2:1637100_at:625:505; Interrogation_Position=1611; Antisense; GTGCCAGACAAGCAGTTCTCCGGTG
>probe:Drosophila_2:1637100_at:504:309; Interrogation_Position=1658; Antisense; CCAGAGGAGTGGACCCGTTGAGTTC
>probe:Drosophila_2:1637100_at:528:717; Interrogation_Position=1701; Antisense; TTCGGTCTCGATCAGTTCTTGAACA
>probe:Drosophila_2:1637100_at:589:183; Interrogation_Position=1732; Antisense; AAAAGGCGCCCAAGCGTGCCGAGGA
>probe:Drosophila_2:1637100_at:598:375; Interrogation_Position=1757; Antisense; GAAGAACAACGAGCGCAGCAGCCAT
>probe:Drosophila_2:1637100_at:284:127; Interrogation_Position=1835; Antisense; ACCAATCATCGTTGTATCGTCATCA

Paste this into a BLAST search page for me
AGCAAATCGCTTTGGGTCTGCCCGCGCAACGGTGAAACGCTCTTCGATCATTCGATCAGCGTCTATTCAACACCAACCAAGGGCATGGACTCCGGTTACGATGTGTACGACAAGCCGTGGCGCGAGTGGCGCGATTCCAATACACTGGGCAACTACGGCGGTGATCTGGATGCCAAAATACCAAGCGTTTCGTGCCAGACGTGCCAGACAAGCAGTTCTCCGGTGCCAGAGGAGTGGACCCGTTGAGTTCTTCGGTCTCGATCAGTTCTTGAACAAAAAGGCGCCCAAGCGTGCCGAGGAGAAGAACAACGAGCGCAGCAGCCATACCAATCATCGTTGTATCGTCATCA

Full Affymetrix probeset data:

Annotations for 1637100_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime