Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637101_at:

>probe:Drosophila_2:1637101_at:15:567; Interrogation_Position=2263; Antisense; GGCAACAACTCCATAAAGACCTTCA
>probe:Drosophila_2:1637101_at:366:551; Interrogation_Position=2310; Antisense; GGAGATCACCGTGCTGCAGAGCAAG
>probe:Drosophila_2:1637101_at:245:101; Interrogation_Position=2327; Antisense; AGAGCAAGGCGGCAGTCAACCAACC
>probe:Drosophila_2:1637101_at:444:595; Interrogation_Position=2396; Antisense; TGTGTGCCAAGCAGGAGAGCGTCCT
>probe:Drosophila_2:1637101_at:640:701; Interrogation_Position=2433; Antisense; TTTTGTGCCGCCAAGCGACGTCGAT
>probe:Drosophila_2:1637101_at:576:629; Interrogation_Position=2467; Antisense; TCCTCCGGGTCCAATTTGAACAACG
>probe:Drosophila_2:1637101_at:356:463; Interrogation_Position=2501; Antisense; GATTGGGAAACACACATCTCTCTCG
>probe:Drosophila_2:1637101_at:723:643; Interrogation_Position=2519; Antisense; TCTCTCGCCAACATTGATTCTCTAG
>probe:Drosophila_2:1637101_at:425:279; Interrogation_Position=2538; Antisense; CTCTAGTAGTGCATGACAACCTCCT
>probe:Drosophila_2:1637101_at:724:611; Interrogation_Position=2551; Antisense; TGACAACCTCCTAGTCTCTTAGTTA
>probe:Drosophila_2:1637101_at:227:301; Interrogation_Position=2576; Antisense; CCCACCCATTTCCATATTCGAAAAG
>probe:Drosophila_2:1637101_at:630:159; Interrogation_Position=2610; Antisense; ACAACGACGCGTTCTCTAGAGGCAT
>probe:Drosophila_2:1637101_at:649:17; Interrogation_Position=2643; Antisense; ATTTCAAATCGGCTTCATCTATCTG
>probe:Drosophila_2:1637101_at:342:271; Interrogation_Position=2658; Antisense; CATCTATCTGAGCTGGTTAATCTGA

Paste this into a BLAST search page for me
GGCAACAACTCCATAAAGACCTTCAGGAGATCACCGTGCTGCAGAGCAAGAGAGCAAGGCGGCAGTCAACCAACCTGTGTGCCAAGCAGGAGAGCGTCCTTTTTGTGCCGCCAAGCGACGTCGATTCCTCCGGGTCCAATTTGAACAACGGATTGGGAAACACACATCTCTCTCGTCTCTCGCCAACATTGATTCTCTAGCTCTAGTAGTGCATGACAACCTCCTTGACAACCTCCTAGTCTCTTAGTTACCCACCCATTTCCATATTCGAAAAGACAACGACGCGTTCTCTAGAGGCATATTTCAAATCGGCTTCATCTATCTGCATCTATCTGAGCTGGTTAATCTGA

Full Affymetrix probeset data:

Annotations for 1637101_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime