FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637103_at:

>probe:Drosophila_2:1637103_at:699:189; Interrogation_Position=1118; Antisense; AACATTGCCAGTATTCTGCGAGCGG
>probe:Drosophila_2:1637103_at:518:121; Interrogation_Position=1138; Antisense; AGCGGCTGCTTTAATGAACTCCATG
>probe:Drosophila_2:1637103_at:12:555; Interrogation_Position=1162; Antisense; GGACCAGCCGTGCAAGAAACTTCTC
>probe:Drosophila_2:1637103_at:490:523; Interrogation_Position=1230; Antisense; GGGCTGTGGTTCCAGGCATCTCCAA
>probe:Drosophila_2:1637103_at:188:347; Interrogation_Position=1245; Antisense; GCATCTCCAAGCTGTATGCCATTGG
>probe:Drosophila_2:1637103_at:181:49; Interrogation_Position=1260; Antisense; ATGCCATTGGTCTGTTTGAGTACTT
>probe:Drosophila_2:1637103_at:379:725; Interrogation_Position=1275; Antisense; TTGAGTACTTGCTGGCCTTGGTGGA
>probe:Drosophila_2:1637103_at:686:681; Interrogation_Position=1346; Antisense; TATGTGGCTCATTTAAGGACCGCGA
>probe:Drosophila_2:1637103_at:173:711; Interrogation_Position=1358; Antisense; TTAAGGACCGCGAGTCTGGTGGCCA
>probe:Drosophila_2:1637103_at:444:111; Interrogation_Position=1387; Antisense; AGCAATGGACCTACTTCGCTTTGAG
>probe:Drosophila_2:1637103_at:55:371; Interrogation_Position=1427; Antisense; GAAGGCTATCTTGCAGACCGGATTT
>probe:Drosophila_2:1637103_at:6:307; Interrogation_Position=1543; Antisense; CCTGCTCCGGCAATTTTTAGTCTAA
>probe:Drosophila_2:1637103_at:610:307; Interrogation_Position=1610; Antisense; CCTTCAGTTGTTGCCACTTTTACAT
>probe:Drosophila_2:1637103_at:650:487; Interrogation_Position=1638; Antisense; GTACCGGCGACATGGTTCAACGTAT

Paste this into a BLAST search page for me
AACATTGCCAGTATTCTGCGAGCGGAGCGGCTGCTTTAATGAACTCCATGGGACCAGCCGTGCAAGAAACTTCTCGGGCTGTGGTTCCAGGCATCTCCAAGCATCTCCAAGCTGTATGCCATTGGATGCCATTGGTCTGTTTGAGTACTTTTGAGTACTTGCTGGCCTTGGTGGATATGTGGCTCATTTAAGGACCGCGATTAAGGACCGCGAGTCTGGTGGCCAAGCAATGGACCTACTTCGCTTTGAGGAAGGCTATCTTGCAGACCGGATTTCCTGCTCCGGCAATTTTTAGTCTAACCTTCAGTTGTTGCCACTTTTACATGTACCGGCGACATGGTTCAACGTAT

Full Affymetrix probeset data:

Annotations for 1637103_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720