FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637106_at:

>probe:Drosophila_2:1637106_at:470:703; Interrogation_Position=1000; Antisense; TTAGAGTGGATCGTGCAGCGCATCA
>probe:Drosophila_2:1637106_at:6:211; Interrogation_Position=1024; Antisense; AAGAACAAATGACCCGCCACACATG
>probe:Drosophila_2:1637106_at:549:547; Interrogation_Position=1193; Antisense; GGAGTCCCTCGATGATTTAAATCTA
>probe:Drosophila_2:1637106_at:605:553; Interrogation_Position=1239; Antisense; GGAGCTAAGCCAATTTAACTACGAT
>probe:Drosophila_2:1637106_at:109:647; Interrogation_Position=693; Antisense; TCTTGGTGGTCAGCAGAGTCTGCGC
>probe:Drosophila_2:1637106_at:629:587; Interrogation_Position=724; Antisense; TGGAGCACCTACTACACGAACACAG
>probe:Drosophila_2:1637106_at:288:537; Interrogation_Position=762; Antisense; GGTCATCGACTCCACGGACCGGGAA
>probe:Drosophila_2:1637106_at:309:329; Interrogation_Position=793; Antisense; GCTGTTACGCGGGAAGAGCTCTACC
>probe:Drosophila_2:1637106_at:326:117; Interrogation_Position=809; Antisense; AGCTCTACCGGATGCTGCAACATGA
>probe:Drosophila_2:1637106_at:88:315; Interrogation_Position=847; Antisense; GCCAGTTTGCTGGTCTATGCCAATA
>probe:Drosophila_2:1637106_at:550:349; Interrogation_Position=873; Antisense; GCAGGATCTCAAGGGCTCTATGTCG
>probe:Drosophila_2:1637106_at:117:575; Interrogation_Position=897; Antisense; GGCGGCGGAAATCTCACGACAACTG
>probe:Drosophila_2:1637106_at:685:105; Interrogation_Position=938; Antisense; AGAAGCACCAATGGCACATCCAGGC
>probe:Drosophila_2:1637106_at:188:261; Interrogation_Position=975; Antisense; CACCGGCGAAGGACTCTATCAAGGA

Paste this into a BLAST search page for me
TTAGAGTGGATCGTGCAGCGCATCAAAGAACAAATGACCCGCCACACATGGGAGTCCCTCGATGATTTAAATCTAGGAGCTAAGCCAATTTAACTACGATTCTTGGTGGTCAGCAGAGTCTGCGCTGGAGCACCTACTACACGAACACAGGGTCATCGACTCCACGGACCGGGAAGCTGTTACGCGGGAAGAGCTCTACCAGCTCTACCGGATGCTGCAACATGAGCCAGTTTGCTGGTCTATGCCAATAGCAGGATCTCAAGGGCTCTATGTCGGGCGGCGGAAATCTCACGACAACTGAGAAGCACCAATGGCACATCCAGGCCACCGGCGAAGGACTCTATCAAGGA

Full Affymetrix probeset data:

Annotations for 1637106_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720