Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637107_at:

>probe:Drosophila_2:1637107_at:365:303; Interrogation_Position=1330; Antisense; CCGATGAGCTGCTCGCCAGTGTCGA
>probe:Drosophila_2:1637107_at:599:501; Interrogation_Position=1350; Antisense; GTCGAGCGGCTATCAATCAACAACA
>probe:Drosophila_2:1637107_at:713:663; Interrogation_Position=1377; Antisense; TAGACGGGACGTAAACTGGACGCCA
>probe:Drosophila_2:1637107_at:155:333; Interrogation_Position=1419; Antisense; GCTGGCCCAAATTGCGTTCGATGAG
>probe:Drosophila_2:1637107_at:230:705; Interrogation_Position=1460; Antisense; TTATCGTTTCCTAATTTGGCTGCCG
>probe:Drosophila_2:1637107_at:38:283; Interrogation_Position=1479; Antisense; CTGCCGTTGAGCTGGAGTTGGCATT
>probe:Drosophila_2:1637107_at:141:77; Interrogation_Position=1519; Antisense; AGGAGATTGAGATCCTGCGCCCGAT
>probe:Drosophila_2:1637107_at:605:445; Interrogation_Position=1541; Antisense; GATCCTAAACCCACAAAGCTGCCAA
>probe:Drosophila_2:1637107_at:493:171; Interrogation_Position=1555; Antisense; AAAGCTGCCAAATGCGACCAACGCT
>probe:Drosophila_2:1637107_at:535:187; Interrogation_Position=1624; Antisense; AACACACATTGTTTTATGCGATCTT
>probe:Drosophila_2:1637107_at:216:657; Interrogation_Position=1713; Antisense; TAAGCTTTACGTTTAGCGCGCCAAA
>probe:Drosophila_2:1637107_at:632:445; Interrogation_Position=1767; Antisense; GATGCAATCGCAACTCAAGAGGACA
>probe:Drosophila_2:1637107_at:141:437; Interrogation_Position=1785; Antisense; GAGGACACCTAACAATTTGCTACAT
>probe:Drosophila_2:1637107_at:246:329; Interrogation_Position=1888; Antisense; GCGTGTAAACACTCTCTGAACAATA

Paste this into a BLAST search page for me
CCGATGAGCTGCTCGCCAGTGTCGAGTCGAGCGGCTATCAATCAACAACATAGACGGGACGTAAACTGGACGCCAGCTGGCCCAAATTGCGTTCGATGAGTTATCGTTTCCTAATTTGGCTGCCGCTGCCGTTGAGCTGGAGTTGGCATTAGGAGATTGAGATCCTGCGCCCGATGATCCTAAACCCACAAAGCTGCCAAAAAGCTGCCAAATGCGACCAACGCTAACACACATTGTTTTATGCGATCTTTAAGCTTTACGTTTAGCGCGCCAAAGATGCAATCGCAACTCAAGAGGACAGAGGACACCTAACAATTTGCTACATGCGTGTAAACACTCTCTGAACAATA

Full Affymetrix probeset data:

Annotations for 1637107_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime