Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637110_at:

>probe:Drosophila_2:1637110_at:220:435; Interrogation_Position=2026; Antisense; GAGGGAATCATTCGGACTGCCATCT
>probe:Drosophila_2:1637110_at:454:165; Interrogation_Position=2069; Antisense; AAATCGAGTGGAATCTCTCCCGGCG
>probe:Drosophila_2:1637110_at:467:201; Interrogation_Position=2122; Antisense; AACCGTGCTGCTAGTGGTTTTCGTG
>probe:Drosophila_2:1637110_at:176:523; Interrogation_Position=2148; Antisense; GGGCCGATACCCACATTGAGAACAC
>probe:Drosophila_2:1637110_at:159:209; Interrogation_Position=2179; Antisense; AAGCAACATCGTCCAGTTTTGCCGT
>probe:Drosophila_2:1637110_at:582:517; Interrogation_Position=2219; Antisense; GTGGTGTGCCAACCGGATCTGAACA
>probe:Drosophila_2:1637110_at:261:613; Interrogation_Position=2238; Antisense; TGAACAACCAGGACCACTCGATGCT
>probe:Drosophila_2:1637110_at:208:445; Interrogation_Position=2257; Antisense; GATGCTTGTCGCAGATCTCGACCAG
>probe:Drosophila_2:1637110_at:116:295; Interrogation_Position=2275; Antisense; CGACCAGGACGGATCTCAGGAGCTA
>probe:Drosophila_2:1637110_at:381:553; Interrogation_Position=2293; Antisense; GGAGCTAGTCACATACATGTCCACC
>probe:Drosophila_2:1637110_at:525:227; Interrogation_Position=2349; Antisense; AATGGAAACTGCTGACCTACGTCCG
>probe:Drosophila_2:1637110_at:224:693; Interrogation_Position=2374; Antisense; TTTGTTGCGCCTCCAAGCAGAGCTA
>probe:Drosophila_2:1637110_at:343:107; Interrogation_Position=2488; Antisense; AGAAGCGTGCTGTCGATCATAAATA
>probe:Drosophila_2:1637110_at:603:305; Interrogation_Position=2555; Antisense; CCTTTTCTAGCCTCCCATAATAAAT

Paste this into a BLAST search page for me
GAGGGAATCATTCGGACTGCCATCTAAATCGAGTGGAATCTCTCCCGGCGAACCGTGCTGCTAGTGGTTTTCGTGGGGCCGATACCCACATTGAGAACACAAGCAACATCGTCCAGTTTTGCCGTGTGGTGTGCCAACCGGATCTGAACATGAACAACCAGGACCACTCGATGCTGATGCTTGTCGCAGATCTCGACCAGCGACCAGGACGGATCTCAGGAGCTAGGAGCTAGTCACATACATGTCCACCAATGGAAACTGCTGACCTACGTCCGTTTGTTGCGCCTCCAAGCAGAGCTAAGAAGCGTGCTGTCGATCATAAATACCTTTTCTAGCCTCCCATAATAAAT

Full Affymetrix probeset data:

Annotations for 1637110_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime