FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637114_at:

>probe:Drosophila_2:1637114_at:64:573; Interrogation_Position=1017; Antisense; GGCTCAGGCTGCTTTTGATATCAAC
>probe:Drosophila_2:1637114_at:637:391; Interrogation_Position=1104; Antisense; GAAACCCCTGATGTATGTGGCCGAA
>probe:Drosophila_2:1637114_at:266:713; Interrogation_Position=1141; Antisense; TTCACCCTGGGAACCTATATGCTTG
>probe:Drosophila_2:1637114_at:445:373; Interrogation_Position=1170; Antisense; GAAGAACTGCTATCGTTTGCTGGCC
>probe:Drosophila_2:1637114_at:717:21; Interrogation_Position=647; Antisense; ATATGGTAGGCATTTCCACGTTCCT
>probe:Drosophila_2:1637114_at:623:323; Interrogation_Position=679; Antisense; GCGCTCAATCTCAAGTTGCTTTGCA
>probe:Drosophila_2:1637114_at:207:343; Interrogation_Position=776; Antisense; GCTTCCACCAGCACATTATCAAATT
>probe:Drosophila_2:1637114_at:116:27; Interrogation_Position=815; Antisense; ATAGAGCTTTCAATGGCGCCTTCAA
>probe:Drosophila_2:1637114_at:419:245; Interrogation_Position=845; Antisense; AATTAATGGCCAGTTTCTCCCTGAT
>probe:Drosophila_2:1637114_at:23:25; Interrogation_Position=874; Antisense; ATATCCACTTTCGAGACCATGGCTG
>probe:Drosophila_2:1637114_at:326:617; Interrogation_Position=897; Antisense; TGCAGCGGCTGTGGATCCCAAAATG
>probe:Drosophila_2:1637114_at:691:215; Interrogation_Position=928; Antisense; AAGTTCGTGCTTCTCATGCTGGTGG
>probe:Drosophila_2:1637114_at:287:593; Interrogation_Position=947; Antisense; TGGTGGCATTCATTCAACTGTCGCT
>probe:Drosophila_2:1637114_at:180:507; Interrogation_Position=975; Antisense; GTGCGTCTCTGGAACTTTGGTTTAT

Paste this into a BLAST search page for me
GGCTCAGGCTGCTTTTGATATCAACGAAACCCCTGATGTATGTGGCCGAATTCACCCTGGGAACCTATATGCTTGGAAGAACTGCTATCGTTTGCTGGCCATATGGTAGGCATTTCCACGTTCCTGCGCTCAATCTCAAGTTGCTTTGCAGCTTCCACCAGCACATTATCAAATTATAGAGCTTTCAATGGCGCCTTCAAAATTAATGGCCAGTTTCTCCCTGATATATCCACTTTCGAGACCATGGCTGTGCAGCGGCTGTGGATCCCAAAATGAAGTTCGTGCTTCTCATGCTGGTGGTGGTGGCATTCATTCAACTGTCGCTGTGCGTCTCTGGAACTTTGGTTTAT

Full Affymetrix probeset data:

Annotations for 1637114_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720