FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637117_at:

>probe:Drosophila_2:1637117_at:576:85; Interrogation_Position=334; Antisense; AGTCGCCACTTTATCGTGGACCAAG
>probe:Drosophila_2:1637117_at:685:207; Interrogation_Position=356; Antisense; AAGCTAGGACGCAAGGTGCCCTTTA
>probe:Drosophila_2:1637117_at:249:535; Interrogation_Position=370; Antisense; GGTGCCCTTTAACTACATCATTATC
>probe:Drosophila_2:1637117_at:413:327; Interrogation_Position=398; Antisense; GCGATCGTGGAAAGCTCAACTATTT
>probe:Drosophila_2:1637117_at:380:363; Interrogation_Position=451; Antisense; GAATAGACTCGTCAACTTCTACGCC
>probe:Drosophila_2:1637117_at:385:679; Interrogation_Position=483; Antisense; TAGTGGTTGCCTTGATGTTGGCCTC
>probe:Drosophila_2:1637117_at:281:59; Interrogation_Position=533; Antisense; ATGTTCATTGTTCCCGGTGATCTGC
>probe:Drosophila_2:1637117_at:702:335; Interrogation_Position=556; Antisense; GCTGCTCAGCTGTTTGGTGGCAATA
>probe:Drosophila_2:1637117_at:28:523; Interrogation_Position=671; Antisense; GTGGCCGTCTGCATGGTGATGTACA
>probe:Drosophila_2:1637117_at:162:443; Interrogation_Position=688; Antisense; GATGTACACGGCTACCATAATCCAT
>probe:Drosophila_2:1637117_at:254:197; Interrogation_Position=737; Antisense; AACGAGTACTTGTTCCTCAGTGTCC
>probe:Drosophila_2:1637117_at:135:93; Interrogation_Position=765; Antisense; AGTTTTTCTCCTACATGATCCTGCA
>probe:Drosophila_2:1637117_at:634:43; Interrogation_Position=797; Antisense; ATCCTGGCCATATCCTTTACAAGTG
>probe:Drosophila_2:1637117_at:295:363; Interrogation_Position=844; Antisense; GCAATTCTCTTTTGGCAGTCGTATG

Paste this into a BLAST search page for me
AGTCGCCACTTTATCGTGGACCAAGAAGCTAGGACGCAAGGTGCCCTTTAGGTGCCCTTTAACTACATCATTATCGCGATCGTGGAAAGCTCAACTATTTGAATAGACTCGTCAACTTCTACGCCTAGTGGTTGCCTTGATGTTGGCCTCATGTTCATTGTTCCCGGTGATCTGCGCTGCTCAGCTGTTTGGTGGCAATAGTGGCCGTCTGCATGGTGATGTACAGATGTACACGGCTACCATAATCCATAACGAGTACTTGTTCCTCAGTGTCCAGTTTTTCTCCTACATGATCCTGCAATCCTGGCCATATCCTTTACAAGTGGCAATTCTCTTTTGGCAGTCGTATG

Full Affymetrix probeset data:

Annotations for 1637117_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720