FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637119_at:

>probe:Drosophila_2:1637119_at:325:593; Interrogation_Position=1671; Antisense; TGGTGGCCCAGTACATGACTCAACT
>probe:Drosophila_2:1637119_at:181:147; Interrogation_Position=1693; Antisense; ACTCTATGACATGATGCAGGCGCAT
>probe:Drosophila_2:1637119_at:10:605; Interrogation_Position=1738; Antisense; TGTTGCAAAGCATCCGGAGAACCGT
>probe:Drosophila_2:1637119_at:35:455; Interrogation_Position=1763; Antisense; GATCACTACGATATCTGGGCGGCAT
>probe:Drosophila_2:1637119_at:206:41; Interrogation_Position=1775; Antisense; ATCTGGGCGGCATTCAAATCCTTTT
>probe:Drosophila_2:1637119_at:125:165; Interrogation_Position=1790; Antisense; AAATCCTTTTCGCATGGGAAGCAAA
>probe:Drosophila_2:1637119_at:82:465; Interrogation_Position=1816; Antisense; GATTGTAAACGGCAGCAACGGTCCC
>probe:Drosophila_2:1637119_at:94:97; Interrogation_Position=1854; Antisense; AGATAGCCAGATACTTTTGCGCCGG
>probe:Drosophila_2:1637119_at:375:415; Interrogation_Position=1898; Antisense; GATCCCTTTCAGCTCTGGGAGGAAC
>probe:Drosophila_2:1637119_at:99:485; Interrogation_Position=1952; Antisense; GTAGCACAGAGGTACCTGCACGTTC
>probe:Drosophila_2:1637119_at:14:577; Interrogation_Position=2032; Antisense; GGCGCAGTACGCCAGACTAATCGAA
>probe:Drosophila_2:1637119_at:310:389; Interrogation_Position=2066; Antisense; GAAAACATACTCTTCATGGCGGAAA
>probe:Drosophila_2:1637119_at:593:25; Interrogation_Position=2113; Antisense; ATAGCGTAGTCCATAATCAATCCAA
>probe:Drosophila_2:1637119_at:597:723; Interrogation_Position=2145; Antisense; TTGAGCACTGTGTTTTTGTACCCCT

Paste this into a BLAST search page for me
TGGTGGCCCAGTACATGACTCAACTACTCTATGACATGATGCAGGCGCATTGTTGCAAAGCATCCGGAGAACCGTGATCACTACGATATCTGGGCGGCATATCTGGGCGGCATTCAAATCCTTTTAAATCCTTTTCGCATGGGAAGCAAAGATTGTAAACGGCAGCAACGGTCCCAGATAGCCAGATACTTTTGCGCCGGGATCCCTTTCAGCTCTGGGAGGAACGTAGCACAGAGGTACCTGCACGTTCGGCGCAGTACGCCAGACTAATCGAAGAAAACATACTCTTCATGGCGGAAAATAGCGTAGTCCATAATCAATCCAATTGAGCACTGTGTTTTTGTACCCCT

Full Affymetrix probeset data:

Annotations for 1637119_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720